AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i301_mixed16_tpal_reg_100.orf -o301_tpal_100.ace -a/home/amcguire/alignace/lib/ORF_tpal.txt -z/skink1/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00110 135 AE000520 #2 RTP00774 72 AE000520 #3 RTP00775 171 AE000520 Motif number 1 ATATCGCAGAGCACCGTTTTTAA 1 2 0 GCACGTTTTA 0.952023 -134 ACGCAGCATTGCACGCCATTCGGCACCATATG 1 36 1 GCACCCTTCG 0.957553 -100 ACGCCATTCGGCACCATATGCAAGAGGCAGAT 1 48 1 GCACATTGCA 0.970105 -88 AGAGGCAGATGCGCAGAATGCGCTCATTGCGC 1 70 1 GCGCGATGCG 0.994832 -66 AAACAGCGCAACGCAGCGCGCAATGAGCGCAT 1 87 0 ACGCGCCGCA 0.975575 -49 GCGCTGCGTTGCGCTGTTTGCGGCACAGGATA 1 100 1 GCGCGTTGCG 0.997745 -36 TTAGGCAAGCGCGCAGCCTGCACACCCGCGGG 2 32 0 GCGCGCTGCA 0.998791 -41 CGCCTCTTCTGCACTGAATCCACTGATACTC 3 10 0 GCACGATCCA 0.98126 -162 GCGCTGCGCAGCGCGGTTTTCAGATTTTGCGC 3 39 0 GCGCGTTTCA 0.994632 -133 AAACCGCGCTGCGCAGCGCCTGGTTAAACGTT 3 52 1 GCGCGCCCTG 0.984472 -120 TCTATTTCAAGCGCAACGTTTAACCAGGCGCT 3 66 0 GCGCACTTTA 0.906966 -106 AGAGTATTCGGCAGGGTACGCGCGCGCTGGTG 3 133 1 GCAGGTCGCG 0.944629 -39 ACCGCGCACAGCCCCCACACCAGCGCG 3 155 0 GCACGCCCCA 0.994086 -17 **** ** **** Masking position 2 Map Score: 29.1762 Number of sites scoring better than the average of aligned sites = 2196 Number in coding regions = 2049 Number in noncoding regions = 147 Number of orfs with sites within 600 bp upstream = 106 Fraction of orfs with sites within 600 bp upstream = 0.0170254 Motif number 2 CGTGTATATCGCAGAGCACCGTTTTTAA 1 9 0 GCAGAGCACC 0.945472 -127 GGCGTGCAATGCTGCGTGTATATCGCAGAG 1 23 0 GCTGCGTGTA 0.910151 -113 AGGCAGATGCGCAGAATGCGCTCATTGCGC 1 72 1 GCAGAATGCG 0.927283 -64 ACAGCGCAACGCAGCGCGCAATGAGCGCAT 1 87 0 GCAGCGCGCA 0.998806 -49 AGGCAAGCGCGCAGCCTGCACACCCGCGGG 2 32 0 GCAGCCTGCA 0.9911 -41 CAGGCGCTGCGCAGCGCGGTTTTCAGATTT 3 44 0 GCAGCGCGGT 0.971148 -128 ACCGCGCTGCGCAGCGCCTGGTTAAACGTT 3 54 1 GCAGCGCCTG 0.989373 -118 AGAGTATTCGGCAGGGTACGCGCGCGCTGG 3 133 1 GCAGGGTACG 0.956429 -39 AGCCCCCACACCAGCGCGCGCGTACCCTGC 3 143 0 CCAGCGCGCG 0.994342 -29 ACCGCGCACAGCCCCCACACCAGCGCG 3 155 0 ACAGCCCCCA 0.900503 -17 ********** Masking position 2 Map Score: 15.027 Number of sites scoring better than the average of aligned sites = 1913 Number in coding regions = 1790 Number in noncoding regions = 123 Number of orfs with sites within 600 bp upstream = 95 Fraction of orfs with sites within 600 bp upstream = 0.0152586 Motif number 3 CAGATGCGCAGAATGCGCTCATTGCGCGCT 1 75 1 GAATGCGCTC 0.922819 -61 TTCCCCGCGGGTGTGCAGGCTGCGCGCTTG 2 29 1 GTGTGCAGGC 0.842467 -44 TCCACCTTAGGCAAGCGCGCAGCCTGCACA 2 40 0 GCAAGCGCGC 0.94138 -33 ATTCAGTGCAGAAGAGGCGCAAAATCTGAA 3 23 1 GAAGAGGCGC 0.929142 -149 TCAGCAGGTTGTCGGGGCGAGTATGGGGGA 3 101 1 GTCGGGGCGA 0.957574 -71 GTCGGGGCGAGTATGGGGGAAGAGAGTATT 3 111 1 GTATGGGGGA 0.97862 -61 ATTCGGCAGGGTACGCGCGCGCTGGTGTGG 3 138 1 GTACGCGCGC 0.960822 -34 GCGCGCGCTGGTGTGGGGGCTGTGCGCGGT 3 152 1 GTGTGGGGGC 0.991116 -20 ********** Masking position 1 Map Score: 7.58384 Number of sites scoring better than the average of aligned sites = 1595 Number in coding regions = 1477 Number in noncoding regions = 118 Number of orfs with sites within 600 bp upstream = 95 Fraction of orfs with sites within 600 bp upstream = 0.0152586 Motif number 4 GGTGCCGAATGGCGTGCAATGCTGCGTGTA 1 33 0 GGCGTGCAAT 0.96481 -103 AGCGCAACGCAGCGCGCAATGAGCGCATTC 1 85 0 AGCGCGCAAT 0.854879 -51 GCAAGCGCGCAGCCTGCACACCCGCGGGGA 2 30 0 AGCCTGCACA 0.989214 -43 CCCCCACACCAGCGCGCGCGTACCCTGCCG 3 141 0 AGCGCGCGCG 0.5206 -31 ACCGCGCACAGCCCCCACACCAGCGCGCG 3 153 0 AGCCCCCACA 0.983394 -19 ********** Masking position 7 Map Score: 3.3371 Number of sites scoring better than the average of aligned sites = 705 Number in coding regions = 650 Number in noncoding regions = 55 Number of orfs with sites within 600 bp upstream = 42 Fraction of orfs with sites within 600 bp upstream = 0.0067459 Motif number 5 TATATCGCAGAGCACCGTTTTTAA 1 5 0 AGCACCGTTT 0.947493 -131 ATTCTGCGCATCTGCCTCTTGCATATGGTG 1 59 0 TCTGCCTCTT 0.852755 -77 GCGCGCAATGAGCGCATTCTGCGCATCTGC 1 74 0 AGCGCATTCT 0.940333 -62 CGCGCTGCGTTGCGCTGTTTGCGGCACAGG 1 99 1 TGCGCTGTTT 0.937257 -37 GGCACAGGATACTGCCTTTTCCTAC 1 121 1 ACTGCCTTTT 0.918459 -15 TTTCAGATTTTGCGCCTCTTCTGCACTGAA 3 24 0 TGCGCCTCTT 0.98975 -148 GGCGCTGCGCAGCGCGGTTTTCAGATTTTG 3 42 0 AGCGCGGTTT 0.976851 -130 CGCGCTGCGCAGCGCCTGGTTAAACGTTGC 3 56 1 AGCGCCTGGT 0.974757 -116 TTCTATTTCAAGCGCAACGTTTAACCAGGC 3 69 0 AGCGCAACGT 0.875234 -103 ********** Masking position 10 Map Score: 6.98242 Number of sites scoring better than the average of aligned sites = 1307 Number in coding regions = 1226 Number in noncoding regions = 81 Number of orfs with sites within 600 bp upstream = 68 Fraction of orfs with sites within 600 bp upstream = 0.0109219 Motif number 6 ********** No masking Map Score: 1.65857e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.65857e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 1.65857e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0