AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i078_aful_mthe_100.orf -o078_aful_mthe_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG49584 45 Archaeoglobus_fulgidus #2 RAG50472 300 Archaeoglobus_fulgidus #3 RAG25757 176 Archaeoglobus_fulgidus #4 RTH01497 23 M.thermo #5 RTH00625 116 M.thermo Motif number 1 AGAATCTCTTTTTCAGAAGACTGTCAGAAG 2 117 1 TTTCAGAAGA 0.987062 -184 TTCAGAAGACTGTCAGAAGAGCCTTGATAT 2 128 1 TGTCAGAAGA 0.993373 -173 AGATTCAGAGTTTCAGATGATCTTGACGAT 2 202 1 TTTCAGATGA 0.940613 -99 GGGGTAAAAATTCCAGAAGAGAACATACTG 2 236 1 TTCCAGAAGA 0.989922 -65 ATACTGCTTGAGCCAGAAGCCAAAAATACA 2 260 1 AGCCAGAAGC 0.964141 -41 AGAGAATCTTTGCCAGAGGTCGGGAAAACC 3 64 1 TGCCAGAGGT 0.951417 -113 AAACAAGTTCTGTCAGCAGATACTCCCATT 3 100 1 TGTCAGCAGA 0.972239 -77 ATGAAAGTCTGAGGAGGTGAAGC 4 6 1 AGTCTGAGGA 0.875295 -18 CATGAAAGATATCCAGAATAAAACCAGGGA 5 40 1 ATCCAGAATA 0.834741 -77 ********** Masking position 4 Map Score: 11.9182 Number of sites scoring better than the average of aligned sites = 406 Number in coding regions = 376 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 2 TATAAATCAATTTCCCTCTTTTATC 1 31 1 TTTCCCTCTT 0.970631 -15 GACGTGTCCCCTTCCCGCCTGCAAGTATTA 2 35 0 CTTCCCGCCT 0.984793 -266 TTGGGCATGGCTTCCCTGCTAAGCGGCCAG 2 66 0 CTTCCCTGCT 0.986796 -235 TTCTGGAATTTTTACCCCCTAAATCGTCAA 2 224 0 TTTACCCCCT 0.974241 -77 TTTGATTTAAATCACCTCCTTATGGGTAAT 3 128 1 ATCACCTCCT 0.954865 -49 GCTTCACCTCCTCAGACTTTCA 4 12 0 TTCACCTCCT 0.985837 -12 CAAACCCCTCTTTCCCTGGTTTTATTCTGG 5 52 0 TTTCCCTGGT 0.953852 -65 ********** Masking position 2 Map Score: 6.68823 Number of sites scoring better than the average of aligned sites = 633 Number in coding regions = 593 Number in noncoding regions = 40 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 3 GATAAAAGAGGGAAATTGATTTA 1 33 0 AAAAGAGGGA 0.902452 -13 ATAAACCAGATACAATGAAAAC 2 3 1 AAACCAGATA 0.915748 -298 CTCTGGCCGCTTAGCAGGGAAGCCATGCCC 2 64 1 TTAGCAGGGA 0.865034 -237 AGTCTTCTGAAAAAGAGATTCTCCAAATAA 2 109 0 AAAAGAGATT 0.723562 -192 GGCATAGCAGATTGCTGGTAATG 2 288 0 ATAGCAGATT 0.777593 -13 GATTCTCTCGAAAACAGGTGTTTCGCCGAA 3 42 0 AAAACAGGTG 0.901244 -135 ACAAGTTCTGTCAGCAGATACTCCCATTTG 3 102 1 TCAGCAGATA 0.743952 -75 AAATTACCCATAAGGAGGTGATTTAAATCA 3 130 0 TAAGGAGGTG 0.91247 -47 AAAAATGTTAAAAGGAGAGTTATTTAAAAT 3 156 0 AAAGGAGAGT 0.902452 -21 ATGAAAGTCTGAGGAGGTGAAGC 4 10 1 TGAGGAGGTG 0.835948 -14 ATCCAGAATAAAACCAGGGAAAGAGGGGTT 5 50 1 AAACCAGGGA 0.952725 -67 TAACAATAAAAGACCAGAGAGAGGTGCTCA 5 96 1 AGACCAGAGA 0.860231 -21 ********** Masking position 6 Map Score: 6.12612 Number of sites scoring better than the average of aligned sites = 1676 Number in coding regions = 1540 Number in noncoding regions = 136 Number of orfs with sites within 600 bp upstream = 112 Fraction of orfs with sites within 600 bp upstream = 0.0179891 Motif number 4 AATGAAAACCATAATACTTGCAGGCGGGAA 2 24 1 ATAATACTTG 0.941351 -277 ATAATCGTTAAAACTGCTTGGGCATGGCTT 2 83 0 AAACTGCTTG 0.974976 -218 AACCACGTATATATCACTTGCATCGGAAAA 2 157 0 ATATCACTTG 0.927265 -144 AGAAGAGAACATACTGCTTGAGCCAGAAGC 2 250 1 ATACTGCTTG 0.989962 -51 GGCATAGCAGATTGCTGGTAATGTATTT 2 283 0 AGATTGCTGG 0.943987 -18 ********** Masking position 3 Map Score: 0.543992 Number of sites scoring better than the average of aligned sites = 99 Number in coding regions = 89 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 5 ********** No masking Map Score: 1.24588e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.24588e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.24588e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0