AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i109_aful_mthe_100.orf -o109_aful_mthe_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH00068 49 M.thermo #2 RTH00701 136 M.thermo Motif number 1 AAAAAGTCGGGGTCTTAAAAATAAAGTAGT 1 24 0 GGTCTTAAAA 0.954308 -26 CTTCAGAAAAAGTCGGGGTC 1 40 0 CTTCAGAAAA 0.911176 -10 GTTCTGGGAATAACTCCCTC 2 1 1 GTTCTGGGAA 0.951784 -136 CAGAGTAGTCCTTCTTTATCTTTCAGGACG 2 30 1 CTTCTTTATC 0.883889 -107 AACATGGGATCGTCCTGAAAGATAAAGAAG 2 40 0 CGTCCTGAAA 0.953463 -97 ATACATATCGGTTCTGTGAAGGAATGAGAA 2 68 0 GTTCTGTGAA 0.953537 -69 ACACCTATATCGACATGGACATATATACAT 2 92 0 CGACATGGAC 0.87321 -45 GGTCTTTAACCTCCATTAACTCAGAACACC 2 117 0 CTCCATTAAC 0.869639 -20 GGTCTTTAACCTCCATTAAC 2 127 0 GGTCTTTAAC 0.97939 -10 ********** Masking position 4 Map Score: 5.09704 Number of sites scoring better than the average of aligned sites = 1240 Number in coding regions = 1164 Number in noncoding regions = 76 Number of orfs with sites within 600 bp upstream = 67 Fraction of orfs with sites within 600 bp upstream = 0.0107613 Motif number 2 AAGGACTACTCTGAGGGAGTTATTCCCAGA 2 13 0 CTGAGGGAGT 0.996793 -124 TATCGGTTCTGTGAAGGAATGAGAACATGG 2 63 0 GTGAAGGAAT 0.986593 -74 TATAGGTGTTCTGAGTTAATGGAGGTTAAA 2 113 1 CTGAGTTAAT 0.980092 -24 ********** Masking position 4 Map Score: 0.0528863 Number of sites scoring better than the average of aligned sites = 140 Number in coding regions = 131 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 3 ********** No masking Map Score: 4.57179e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 4.57179e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 4.57179e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0