AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i118_aful_mthe_100.orf -o118_aful_mthe_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01810 103 M.thermo Motif number 1 TCTATTTGACAGATGGGAGA 1 1 1 TCTATTTGAC 0.924794 -103 AGGTGATCGTCTTGATTGACCGCATTTTAA 1 39 1 CTTGATTGAC 0.980454 -65 CTATGAGTGGCCTGTATGACTTTAAAATGC 1 60 0 CCTGTATGAC 0.997253 -44 GTTATGGCTGCTGGTATGGCTATGAGTGGC 1 79 0 CTGGTATGGC 0.996355 -25 TTACAGTTATGGCTGCTGGTATG 1 91 0 CAGTTATGGC 0.97521 -13 ********** Masking position 7 Map Score: 5.29615 Number of sites scoring better than the average of aligned sites = 292 Number in coding regions = 273 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 2 GTTTCTCCCATCTGTCAAATAGA 1 4 0 TCTGTCAAAT 0.972162 -100 GATGGGAGAAACTTTAAAGGTGATCGTCTT 1 22 1 ACTTTAAAGG 0.515105 -82 GGCCTGTATGACTTTAAAATGCGGTCAATC 1 52 0 ACTTTAAAAT 0.537237 -52 ********** Masking position 7 Map Score: 0.329093 Number of sites scoring better than the average of aligned sites = 45 Number in coding regions = 37 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 3 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0