AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i150_aful_mthe_300.orf -o150_aful_mthe_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Purged sequences: RAG14760 16 Archaeoglobus_fulgidus Input sequences: #1 RAG14667 172 Archaeoglobus_fulgidus #2 RAG49982 24 Archaeoglobus_fulgidus #3 RAG14774 49 Archaeoglobus_fulgidus #4 RTH00559 35 M.thermo #5 RTH00866 17 M.thermo #6 RTH00917 212 M.thermo #7 RTH01204 103 M.thermo #8 RTH02032 21 M.thermo Motif number 1 TATATATCCGCCCCTGCTGACCGAAAACGG 1 38 0 CCCCTGCTGA 0.958785 -135 GGTAACCACCCTGATCAAACTCTA 1 159 0 ACCACCCTGA 0.974794 -14 TCATCTCACCTCCTCAAACACACC 2 9 0 CACCTCCTCA 0.95108 -16 CCACCCCCAACATCCTTTTTCA 4 3 1 ACCCCCAACA 0.938033 -33 TGGCTAACTCTCCTGAAAAAGGATGT 4 20 0 ACTCTCCTGA 0.883714 -16 AATTCACCCATCAACATCCATATGAT 6 7 1 CCCATCAACA 0.941978 -206 GCCTTTTGAATCCCTCCTGATGTTAATTGA 6 98 0 TCCCTCCTGA 0.98185 -115 CCGGGCAGATCCCACCATCACATCACAATT 7 23 0 CCCACCATCA 0.980528 -81 GTCGATCAGTTCCAGCATCACCGGGCAGAT 7 43 0 TCCAGCATCA 0.8639 -61 ********** Masking position 10 Map Score: 7.10568 Number of sites scoring better than the average of aligned sites = 1588 Number in coding regions = 1505 Number in noncoding regions = 83 Number of orfs with sites within 600 bp upstream = 63 Fraction of orfs with sites within 600 bp upstream = 0.0101189 Motif number 2 TTAATTATATATCCGCCCCTGCTGACCGAA 1 43 0 ATCCGCCCCT 0.943549 -130 GGTAACCACCCTGATCAAACTCT 1 160 0 AACCACCCTG 0.955706 -13 TCATCTCACCTCCTCAAACACA 2 13 0 ATCTCACCTC 0.921041 -12 TGGCTAACTCTCCTGAAAAAGGATG 4 21 0 AACTCTCCTG 0.969237 -15 CTGTTATCTCCCCTTTT 5 3 0 ATCTCCCCTT 0.98638 -15 AGCCTTTTGAATCCCTCCTGATGTTAATTG 6 99 0 ATCCCTCCTG 0.988695 -114 TGATGGTGGGATCTGCCCGGTGATGCTGGA 7 33 1 ATCTGCCCGG 0.976169 -71 ********** Masking position 1 Map Score: 5.31905 Number of sites scoring better than the average of aligned sites = 358 Number in coding regions = 339 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 3 GGTGTGTTTGAGGAGGTGAGATGA 2 10 1 GAGGAGGTGA 0.953049 -15 AAACAATTTTTAGAGGTGACAGGGAATGG 3 10 1 TTAGAGGTGA 0.979614 -40 AAAAAGGATGTTGGGGGTGG 4 1 0 TTGGGGGTGG 0.990567 -35 ATATGGATGTTGATGGGTGAATT 6 4 0 TGATGGGTGA 0.841124 -209 ATTTAAGTCTTTAAGGGTGATCGGCAATCA 6 33 0 TTAAGGGTGA 0.962309 -180 GAATTGTGATGTGATGGTGGGATCTGCCCG 7 22 1 GTGATGGTGG 0.881013 -82 TAAAGTTAAACTGGAGGTGAAAAA 7 90 1 CTGGAGGTGA 0.978122 -14 ********** Masking position 8 Map Score: 4.07052 Number of sites scoring better than the average of aligned sites = 609 Number in coding regions = 555 Number in noncoding regions = 54 Number of orfs with sites within 600 bp upstream = 48 Fraction of orfs with sites within 600 bp upstream = 0.0077096 Motif number 4 AGGGGCGGATATATAATTAATCCTCGTTTT 1 53 1 ATATAATTAA 0.871806 -120 CAGGTAGAATTTGTAATTAAAAACGAGGAT 1 72 0 TTGTAATTAA 0.913184 -101 AGGCTTTCGAATGTCTTTAAAGTTTAGAGT 1 135 1 ATGTCTTTAA 0.749391 -38 TGAAATTTAATTTGAATTAAGACAATATTT 6 59 0 TTTGAATTAA 0.925473 -154 TTCAAATTAAATTTCATAAAATGACTCAAT 6 73 1 ATTTCATAAA 0.926178 -140 GATTAGTTGAATATCATAAACTTTTGAATA 6 144 1 ATATCATAAA 0.870537 -69 ATCATAAACTTTTGAATAAAATAGTAAAAG 6 156 1 TTTGAATAAA 0.885559 -57 GAAATAGACCTTTGCATTAATAGG 6 199 1 TTTGCATTAA 0.95173 -14 ********** Masking position 9 Map Score: 3.17703 Number of sites scoring better than the average of aligned sites = 140 Number in coding regions = 109 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 5 TTACACAGGTAGAATTTGTAATTAAAAACG 1 77 0 AGAATTTGTA 0.958107 -96 AAGCTTAAATACGATTTGTAAGGCTTTCGA 1 115 1 ACGATTTGTA 0.972946 -58 AAACAATTTTTAGAGGTGACAG 3 3 1 ACAATTTTTA 0.975367 -47 TTGAATTAAGACAATATTTAAGTCTTTAAG 6 48 0 ACAATATTTA 0.939747 -165 ********** Masking position 5 Map Score: 0.786342 Number of sites scoring better than the average of aligned sites = 13 Number in coding regions = 6 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 6 ********** No masking Map Score: 1.65089e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.65089e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 1.65089e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0