AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i188_aful_mthe_300.orf -o188_aful_mthe_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG50316 32 Archaeoglobus_fulgidus #2 RAG50315 50 Archaeoglobus_fulgidus #3 RAG38518 27 Archaeoglobus_fulgidus #4 RAG47382 65 Archaeoglobus_fulgidus #5 RAG47360 118 Archaeoglobus_fulgidus #6 RAG47379 50 Archaeoglobus_fulgidus #7 RAG47336 187 Archaeoglobus_fulgidus Motif number 1 AAAAATGTACTGGAAAATAC 1 1 0 TGGAAAATAC 0.903172 -32 CTCCGGGCAGGGAAAAATGTACTGGAAA 1 15 0 AGGGAAAAAT 0.950019 -18 AACTATCTGTTGGAAAAAATAAAAATTAAA 4 12 0 TGGAAAAAAT 0.967863 -54 CATAGGGGACTGGGAAAAACCGAAGGTTAG 5 38 1 TGGGAAAAAC 0.993437 -81 CCTCGCTTTCCTGGAGAAACATTGTTCTG 5 100 1 CTGGAGAAAC 0.959628 -19 AAATCAGAAACGGGAAAAATTGAAAAGAGG 6 11 0 CGGGAAAAAT 0.986931 -40 GCACCTCCTGTGTGAAAAATCAGAAACGGG 6 27 0 TGTGAAAAAT 0.938162 -24 AAGAATCGAATTTAAAAAACTTTTTGAACT 7 21 0 TTTAAAAAAC 0.792471 -167 AATGGACTTTCTGTAGAAACTTATTAAGAA 7 154 0 CTGTAGAAAC 0.786195 -34 ********** Masking position 5 Map Score: 10.0391 Number of sites scoring better than the average of aligned sites = 626 Number in coding regions = 556 Number in noncoding regions = 70 Number of orfs with sites within 600 bp upstream = 70 Fraction of orfs with sites within 600 bp upstream = 0.0112432 Motif number 2 AGGCTTCCCGGAAGTGGTGGAGCAAACGAT 5 66 1 GAAGTGGTGG 0.996257 -53 TTTCACACAGGAGGTGCAGAG 6 40 1 GAGGTGCAGA 0.967931 -11 ATCCACGCACGAAGTGGTTGGGTGAAAGCG 7 59 1 GAAGTGGTTG 0.980756 -129 TGGAATTTGCGAGGTAGTGAGCAGCGCTTT 7 83 0 GAGGTAGTGA 0.980772 -105 AAGTCCATTTGAGGTGATGGTGA 7 175 1 GAGGTGATGG 0.993419 -13 ********** Masking position 5 Map Score: 5.16068 Number of sites scoring better than the average of aligned sites = 645 Number in coding regions = 604 Number in noncoding regions = 41 Number of orfs with sites within 600 bp upstream = 40 Fraction of orfs with sites within 600 bp upstream = 0.00642467 Motif number 3 TATTTTGCTGTAATTTTTAAT 2 1 0 TAATTTTAAT 0.985029 -50 AATAGTAATATATATGTTAATCAAAGCAATT 2 28 1 TATATTTAAT 0.933125 -23 TTTTAATTTTTATTTTTTCCAACA 4 4 1 TAATTTTATT 0.952376 -62 ATTCGATTCTTAAATAATAATCCACGCACGA 7 40 1 TAAATATAAT 0.933125 -148 GAATTATTGATAATTCTTAATAAGTTTCTAC 7 141 1 TAATTTTAAT 0.985029 -47 ***** ***** Masking position 5 Map Score: 3.05902 Number of sites scoring better than the average of aligned sites = 15 Number in coding regions = 3 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 4 AATCCAGTCGTCCAAAGGAGTATA 3 5 0 TCCAAAGGAG 0.96502 -23 AGCCAACAGGGAGATTTCTCA 4 55 0 GCCAACAGGG 0.984674 -11 TGTTGATGTTGCCATAGGGG 5 1 0 GCCATAGGGG 0.992723 -118 CAACACAACAGTCATAGGGGACTGGGAAAA 5 26 1 GTCATAGGGG 0.989732 -93 ********** Masking position 4 Map Score: 2.74723 Number of sites scoring better than the average of aligned sites = 119 Number in coding regions = 111 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 5 ATATATATTACTATTTTGCTGTAATTTTTA 2 13 0 CTATTTTGCT 0.949694 -38 ACTGTTGTGTTGATGTTGCCATAGGGG 5 8 0 TGATGTTGCC 0.959241 -111 GCCTAACCTTCGGTTTTTCCCAGTCCCCTA 5 40 0 CGGTTTTTCC 0.929018 -79 GTGGAGCAAACGATGTCGCCTCGCTTTCCT 5 82 1 CGATGTCGCC 0.985151 -37 CAGAACAATGTTTCTCCAGGAAAGC 5 104 0 CAATGTTTCT 0.949694 -15 CCTCTTTTCAATTTTTCCCGTTTCTGAT 6 9 1 CAATTTTTCC 0.949694 -42 TTATGTGCAGCTATGTAGCTGGAATTTGCG 7 102 0 CTATGTAGCT 0.90583 -86 ********** Masking position 6 Map Score: 4.57229 Number of sites scoring better than the average of aligned sites = 393 Number in coding regions = 369 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 6 AAGTGGTGGAGCAAACGATGTCGCCTCGCT 5 77 1 GCAAACGATG 0.983664 -42 GTTTCTCCAGGAAAGCGAGGCGACATCGTT 5 90 0 GAAAGCGAGG 0.993909 -29 GTGGTTGGGTGAAAGCGCTGCTCACTACCT 7 72 1 GAAAGCGCTG 0.993901 -116 ********** Masking position 4 Map Score: 0.191092 Number of sites scoring better than the average of aligned sites = 52 Number in coding regions = 51 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 7 ********** No masking Map Score: 8.19556e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 8.19556e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 8.19556e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0