AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i197_aful_mthe_100.orf -o197_aful_mthe_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG46048 274 Archaeoglobus_fulgidus #2 RAG00509 300 Archaeoglobus_fulgidus #3 RAG50452 34 Archaeoglobus_fulgidus Motif number 1 AGCAAAATTTTAAAGCATCAATTT 1 5 1 AAATTTTAAA 0.959305 -270 TTTGAGCGAAAGAGTTTTAATTCAAGTTGG 1 211 0 AGAGTTTTAA 0.95641 -64 TCAAGTGCTCAAAGTTTTAAACACTCCCTC 1 243 1 AAAGTTTTAA 0.957238 -32 CCATTCTACAAAATTTGTAACTAGACAATA 2 55 0 AAATTTGTAA 0.915662 -246 GCATTTTGTGAGATATTTAATTAAATTCAA 2 84 1 AGATATTTAA 0.877752 -217 AGAAGTCAAAAAATTTTTAACTTAGTATTT 2 116 0 AAATTTTTAA 0.981153 -185 ACTTCTAAGTATATTTTAAATCAATCGAGG 2 140 1 ATATTTTAAA 0.91115 -161 AAGATATAGGAATTTTTAAAAGACACAAAA 2 183 0 AATTTTTAAA 0.867599 -118 GTATTATTTTATTTTTTTAATTTCAATGAA 2 229 0 ATTTTTTTAA 0.86293 -72 ATAAGCACTTTGATTTTTAATACGTTATGT 2 257 0 TGATTTTTAA 0.877752 -44 ********** Masking position 6 Map Score: 12.1598 Number of sites scoring better than the average of aligned sites = 212 Number in coding regions = 89 Number in noncoding regions = 123 Number of orfs with sites within 600 bp upstream = 144 Fraction of orfs with sites within 600 bp upstream = 0.0231288 Motif number 2 TTTTCCCATCAAACGCATTTAACAGCCAGA 1 34 1 AAACGCATTT 0.68436 -241 CCTGCATAAAAAAAGCATTTTACCTTTTCA 1 88 1 AAAAGCATTT 0.688173 -187 AGTTGGGCTAAATGGCATTGAGCCGAGGTA 1 187 0 AATGGCATTG 0.937685 -88 AATTTTGTAGAATGGCATTTTGTGAGATAT 2 70 1 AATGGCATTT 0.949067 -231 CTTAGTATTTATTTGAATTTAATTAAATAT 2 96 0 ATTTGAATTT 0.724615 -205 AAAATAAGATATAGGAATTTTTAAAAGACA 2 188 0 ATAGGAATTT 0.931049 -113 ATCTTTGTTAATAAGCACTTTGATTTTTAA 2 267 0 ATAAGCACTT 0.870558 -34 ********** Masking position 7 Map Score: 3.72471 Number of sites scoring better than the average of aligned sites = 114 Number in coding regions = 96 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 3 TTTCAACCATGCCGAGGGGGGGATTCGAAC 1 113 1 GCCGAGGGGG 0.997624 -162 ATGGCATTGAGCCGAGGTAGCCTAGCTGGT 1 176 0 GCCGAGGTAG 0.996926 -99 TTTTAACAGTCTGAGGGAGTGTTTAAAAC 1 256 0 TCTGAGGGAG 0.969496 -19 TGCAAAAATTGCCAAGGTTGTGGTATTTAT 2 14 1 GCCAAGGTTG 0.978856 -287 ********** Masking position 5 Map Score: 3.05609 Number of sites scoring better than the average of aligned sites = 149 Number in coding regions = 147 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 ********** No masking Map Score: -1.07049e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.07049e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 AATGCGTTTGATGGGAAAAAATTGATGCTTT 1 22 0 ATGGAAAAAA 0.926463 -253 AAACGCATTTAACAGCCAGAAGGTTGCTGCA 1 44 1 AACGCCAGAA 0.91806 -231 AACTGCAAAAATTGCCAAGGT 2 1 1 AACGCAAAAA 0.95119 -300 TTAATTAAATATCTCACAAAATGCCATTCTA 2 77 0 ATCCACAAAA 0.951943 -224 ATATACTTAGAAGTCAAAAAATTTTTAACTT 2 123 0 AAGCAAAAAA 0.959194 -178 GAATTTTTAAAAGACACAAAAGATATATATA 2 173 0 AAGCACAAAA 0.973658 -128 *** ******* Masking position 8 Map Score: 0.149593 Number of sites scoring better than the average of aligned sites = 114 Number in coding regions = 93 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 7 ********** No masking Map Score: -1.07049e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -1.07049e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -1.07049e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0