AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i200_aful_mthe_300.orf -o200_aful_mthe_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH00601 195 M.thermo Motif number 1 GTGGGATTATATTTCAGGGTCAACTTATAT 1 42 1 ATTTCAGGGT 0.974498 -154 ATATATACCTTTGCCAGGATACATAAAGTT 1 68 1 TTGCCAGGAT 0.981874 -128 AGTCTCATATCTGACAGGGTATCCCACGTG 1 106 1 CTGACAGGGT 0.993574 -90 TGGGGGTATCATCACAGGATTATGGAACAC 1 133 0 ATCACAGGAT 0.982468 -63 TTAAACATAAATCAGAGGATGGTAATGATA 1 174 1 ATCAGAGGAT 0.972474 -22 ********** Masking position 6 Map Score: 5.5611 Number of sites scoring better than the average of aligned sites = 101 Number in coding regions = 92 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 2 CCACAATAGAATGAGGTTCTTATTTTAAGT 1 16 0 ATGAGGTTCT 0.979294 -180 TCATTCTATTGTGGGATTATATTTCAGGGT 1 32 1 GTGGGATTAT 0.989866 -164 CCTGTCAGATATGAGACTCCAGACTCAACT 1 94 0 ATGAGACTCC 0.965175 -102 TATGGAACACGTGGGATACCCTGTCAGATA 1 113 0 GTGGGATACC 0.986474 -83 AACAAGTTCAGTGGGGGTATCATCACAGGA 1 144 0 GTGGGGGTAT 0.984247 -52 ********** Masking position 2 Map Score: 2.70592 Number of sites scoring better than the average of aligned sites = 248 Number in coding regions = 227 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 3 AAATCACTTAAAATAAGAACCTCATTC 1 8 1 TTAAAATAAG 0.842408 -188 AGTTGACCCTGAAATATAATCCCACAATAG 1 37 0 GAAATATAAT 0.947294 -159 CTGGCAAAGGTATATATAAGTTGACCCTGA 1 55 0 TATATATAAG 0.921341 -141 CCTTTGCCAGGATACATAAAGTTGAGTCTG 1 75 1 GATACATAAA 0.974049 -121 TATCCCACGTGTTCCATAATCCTGTGATGA 1 125 1 GTTCCATAAT 0.88828 -71 GAACTTGTTTTAAACATAAATCAGAGGATG 1 165 1 TAAACATAAA 0.962048 -31 ********** Masking position 6 Map Score: 1.9134 Number of sites scoring better than the average of aligned sites = 111 Number in coding regions = 81 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 4 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0