AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i286_aful_mthe_300.orf -o286_aful_mthe_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01355 147 M.thermo #2 RTH00374 143 M.thermo #3 RTH01852 135 M.thermo Motif number 1 TCATGGGGTTATTACGGCAGCCTCTTCCCCT 1 16 1 ATACGGCAGC 0.987834 -132 GGTGAGCAACATCGCTGCAGCGACTCAGAGA 2 20 0 ATGCTGCAGC 0.990911 -124 CTCACCAGTAAGGCCGGCGCCAATGACTTTG 2 45 1 AGCCGGCGCC 0.989347 -99 AGGTTAATTGATGCCTGCGGAGGTTTATAA 2 124 1 ATCCTGCGGA 0.992311 -20 AAAAATCCGTATACCTGCGGCAGGTGGGACA 3 92 0 ATCCTGCGGC 0.998517 -44 ** ******** Masking position 1 Map Score: 5.11429 Number of sites scoring better than the average of aligned sites = 101 Number in coding regions = 94 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 2 AGGACTCATGGGGTTATTACGGCAGCCTC 1 10 1 GGGGTTATTA 0.847525 -138 TAGGGGATCCGATGATTAAACACTTGAAGG 1 44 0 GATGATTAAA 0.753868 -104 CATGATTATTTATGATAATATAAAGTTTTC 1 93 0 TATGATAATA 0.703696 -55 CATAAATAATCATGTTAATTATTGGTACTA 1 109 1 CATGTTAATT 0.915628 -39 CAATGACTTTGAGGTTAAATTTCTGGGATT 2 65 1 GAGGTTAAAT 0.925813 -79 ATTCTGACTTGAGGTTAATTGATGCCTGCG 2 113 1 GAGGTTAATT 0.975303 -31 GATGCCTGCGGAGGTTTATAA 2 133 1 GAGGTTTATA 0.975303 -11 CTGATACGCTCATGTTTTTATTACAGCACT 3 29 1 CATGTTTTTA 0.774237 -107 CAGCACTATAGATATTAATATGGGATAAGT 3 52 1 GATATTAATA 0.85143 -84 ********** Masking position 6 Map Score: 4.30408 Number of sites scoring better than the average of aligned sites = 625 Number in coding regions = 544 Number in noncoding regions = 81 Number of orfs with sites within 600 bp upstream = 82 Fraction of orfs with sites within 600 bp upstream = 0.0131706 Motif number 3 CATGGGGTTATTACGGCAGCCTCTTCCCCT 1 17 1 TTACGGCAGC 0.960485 -131 TTTCTCTGAGTCGCTGCAGCGATGTTGCTC 2 18 1 TCGCTGCAGC 0.989133 -126 TCAAAGTCATTGGCGCCGGCCTTACTGGTG 2 47 0 TGGCGCCGGC 0.99143 -97 GGTTAATTGATGCCTGCGGAGGTTTATAA 2 125 1 TGCCTGCGGA 0.986354 -19 AAAATCCGTATACCTGCGGCAGGTGGGACA 3 92 0 TACCTGCGGC 0.992825 -44 ********** Masking position 1 Map Score: 2.67981 Number of sites scoring better than the average of aligned sites = 183 Number in coding regions = 169 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 4 TTAAACACTTGAAGGGGAAGAGGCTGCCGTA 1 28 0 GAAGGGGAAA 0.946934 -120 GTACTAAAGAGAAGGGAGCTATAAA 1 133 1 GAAGGGAGCA 0.989375 -15 GCCGGCCTTACTGGTGAGCAACATCGCTGCA 2 32 0 CTGGTGAGCA 0.95105 -112 ATACCTGCGGCAGGTGGGACATACACTTATA 3 82 0 CAGGTGGGAA 0.984599 -54 GATTTTTCCGGAAGTGGGCCAGCAATTCAG 3 116 1 GAAGTGGGCA 0.994881 -20 ********* * Masking position 11 Map Score: 0.660258 Number of sites scoring better than the average of aligned sites = 440 Number in coding regions = 412 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 5 TGATTAAACACTTGAAGGGGAAGAGGCTGC 1 32 0 CTTGAAGGGG 0.871914 -116 TCTCTGAGTCGCTGCAGCGATGTTGCTCAC 2 20 1 GCTGCAGCGA 0.964302 -124 ACCAGTAAGGCCGGCGCCAATGACTTTGAG 2 48 1 CCGGCGCCAA 0.67822 -96 TTAATTGATGCCTGCGGAGGTTTATAA 2 127 1 CCTGCGGAGG 0.665714 -17 AATCCGTATACCTGCGGCAGGTGGGACATA 3 90 0 CCTGCGGCAG 0.895377 -46 ACGGATTTTTCCGGAAGTGGGCCAGCAATT 3 113 1 CCGGAAGTGG 0.960256 -23 ********** Masking position 4 Map Score: 0.622975 Number of sites scoring better than the average of aligned sites = 1055 Number in coding regions = 992 Number in noncoding regions = 63 Number of orfs with sites within 600 bp upstream = 51 Fraction of orfs with sites within 600 bp upstream = 0.00819146 Motif number 6 ********** No masking Map Score: -2.03625e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.03625e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -2.03625e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0