AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i309_aful_mthe_100.orf -o309_aful_mthe_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG23596 126 Archaeoglobus_fulgidus Motif number 1 TCAGCTTTAAAACCTTTTCAGGTGAGAATT 1 26 1 AACCTTTTCA 0.994993 -101 TTTATGTTTAAAAATTCTCACCTGAAAAGG 1 38 0 AAAATTCTCA 0.963732 -89 AAACATAAACAACATTATCTATAACTTCTT 1 59 1 AACATTATCT 0.984901 -68 CATTATCTATAACTTCTTCACGATAGCGAG 1 71 1 AACTTCTTCA 0.990697 -56 AAAGAATATTAACTTTTTCTCGCTATCGTG 1 89 0 AACTTTTTCT 0.993969 -38 ********** Masking position 5 Map Score: 7.46811 Number of sites scoring better than the average of aligned sites = 338 Number in coding regions = 301 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 39 Fraction of orfs with sites within 600 bp upstream = 0.00626405 Motif number 2 GATGTTAAATTGTCGTCAGCTT 1 1 1 GTGTTAATTG 0.983538 -126 CACCTGAAAAGGTTTTAAAGCTGACGACAATT 1 18 0 GTTTTAAGCT 0.990867 -109 TATAGATAATGTTGTTTATGTTTAAAAATTCT 1 50 0 GTGTTATGTT 0.993966 -77 TTCTTTCAGAGTTTTTGAAGTTCA 1 113 1 GTTTTAAGTT 0.996265 -14 * **** ***** Masking position 6 Map Score: 2.47909 Number of sites scoring better than the average of aligned sites = 135 Number in coding regions = 112 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 3 ********** No masking Map Score: -2.03625e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -2.03625e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.03625e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0