AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i027_bsub_mtub_100.orf -o027_bsub_mtub_100.ace -a/home/amcguire/genomes/ORF_bsub.txt -z/home/amcguire/genomes/bsub.fna -g0.55 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.55 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 citG 300 fumarate hydratase #2 fum 30 fum #3 Rv1099c 100 hypothetical protein Rv1099c Motif number 1 ATTTCTTCTTGTTTTCCAGCTAGCCTTACCTGTGCCACTT 1 57 0 GTCCAGCCAC 0.996997 -244 ATACATCAAAGGAGTACGGCAGGACAAATCCAAAATACAA 1 141 1 GGCCGGACAC 0.996219 -160 CACACCCACGACACACAAGGAACCCGATCA 2 10 1 GACGAACCAC 0.946077 -21 TGGCCACCGCGGCCGTCGACGAACCGGATCCCTCAGCTGT 3 12 0 GGCCAACCAC 0.997904 -89 GGTGTGCGACGGGTCGTGGCTGGCCACCGCGGCCGTCGAC 3 32 0 GGTCGGCCCC 0.994377 -69 GCCACGACCCGTCGCACACCAGGCCATCGCGCCGGGAAGC 3 52 1 GTCCGGCCCC 0.99784 -49 CCATCGCGCCGGGAAGCCCCGGACCGCAACCTGGCC 3 75 1 GGCCGACCAC 0.76659 -26 ** * * **** * * Masking position 15 Map Score: 9.21486 Number of sites scoring better than the average of aligned sites = 103 Number in coding regions = 99 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 CACTTCGTATCCTCCGCTTTCATAAAAAAAC 1 31 0 CCTCCGCTTC 0.989923 -270 GAACCGGATCCCTCAGCTGTC 3 1 0 CCTCAGCTGC 0.987827 -100 TGGCTGGCCACCGCGGCCGTCGACGAACCGG 3 25 0 CCGCGGCCGC 0.997679 -76 GTGCGACGGGTCGTGGCTGGCCACCGCGGCC 3 38 0 TCGTGGCTGC 0.984956 -63 CAGCCACGACCCGTCGCACACCAGGCCATCG 3 50 1 CCGTCGCACC 0.970556 -51 AGGTTGCGGTCCGGGGCTTCCCGGCGCGATG 3 76 0 CCGGGGCTTC 0.993709 -25 ********* * Masking position 6 Map Score: 5.14044 Number of sites scoring better than the average of aligned sites = 673 Number in coding regions = 611 Number in noncoding regions = 62 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 3 AGCTCATTAGATCATTTGAACAGCATTATG 1 102 1 ATCATTTGAA 0.962074 -199 TCCTGCCGTACTCCTTTGATGTATAAGAGA 1 135 0 CTCCTTTGAT 0.960569 -166 ATACGCGGGAATCCTTTGAATATTTGTATT 1 174 0 ATCCTTTGAA 0.993816 -127 GACACAAAAAATCCTTTTTATTTTTCGATC 1 232 0 ATCCTTTTTA 0.919478 -69 GCGAATTATGATCTATTGAAGCAACCGTTA 1 266 1 ATCTATTGAA 0.920233 -35 ********** Masking position 6 Map Score: 3.07023 Number of sites scoring better than the average of aligned sites = 329 Number in coding regions = 298 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 4 TAAAAAAACTTACTCCATGAAATACTCTA 1 10 0 TACTCCATGA 0.914494 -291 ATCAAAGGAGTACGGCAGGACAAATCCAAA 1 145 1 TACGGCAGGA 0.974493 -156 ACACCCACGACACACAAGGAACCCGATCA 2 12 1 CACACAAGGA 0.977024 -19 CGACCCGTCGCACACCAGGCCATCGCGCCG 3 56 1 CACACCAGGC 0.990095 -45 ACCAGGCCATCGCGCCGGGAAGCCCCGGAC 3 69 1 CGCGCCGGGA 0.985846 -32 ********** Masking position 3 Map Score: 1.01353 Number of sites scoring better than the average of aligned sites = 274 Number in coding regions = 260 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 5 CATTTGAACAGCATTATGATGTCTCTTATA 1 114 1 GCATTATGAT 0.984532 -187 CGTATATCTTGAATTAAAATTAAAATCTGC 1 199 1 GAATTAAAAT 0.940264 -102 TGTCATTGGCGAATTATGATCTATTGAAGC 1 258 1 GAATTATGAT 0.986966 -43 ********** Masking position 6 Map Score: 0.154861 Number of sites scoring better than the average of aligned sites = 48 Number in coding regions = 36 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 6 TAGAGTATTTCATGGAGTAAGTTT 1 5 1 GTATTTCATG 0.94891 -296 ATGGAGTAAGTTTTTTTATGAAAGCGGAGG 1 22 1 TTTTTTTATG 0.798253 -279 AGCTGTTCAATTTCTTCTTGTTTTCCAGCT 1 76 0 TTTCTTCTTG 0.81993 -225 CTTTGAATATTTGTATTTTGGATTTGTCCT 1 161 0 TTGTATTTTG 0.859557 -140 GGATTCCCGCGTATATCTTGAATTAAAATT 1 190 1 GTATATCTTG 0.94891 -111 AAAATCCTTTTTATTTTTCGATCTTGGCAG 1 225 0 TTATTTTTCG 0.842673 -76 AAAATAAAAAGGATTTTTTGTGTCATTGGC 1 238 1 GGATTTTTTG 0.947679 -63 TGATCGGGTTCCTTGTGTGTCGTGG 2 16 0 GGGTTCCTTG 0.863503 -15 ********** Masking position 10 Map Score: 0.485067 Number of sites scoring better than the average of aligned sites = 1696 Number in coding regions = 1424 Number in noncoding regions = 272 Number of orfs with sites within 600 bp upstream = 266 Fraction of orfs with sites within 600 bp upstream = 0.0427241 Motif number 7 ********** No masking Map Score: -7.57849e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -7.57849e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -7.57849e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0