AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i027_bsub_mtub_300.orf -o027_bsub_mtub_300.ace -a/home/amcguire/genomes/ORF_bsub.txt -z/home/amcguire/genomes/bsub.fna -g0.55 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.55 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 citG 300 fumarate hydratase #2 fum 30 fum #3 Rv1099c 100 hypothetical protein Rv1099c Motif number 1 GCACAGGTAAGGCTAGCTGGAAAACAAGAA 1 62 1 GGCTAGCTGG 0.95575 -239 AATATTCAAAGGATTCCCGCGTATATCTTG 1 180 1 GGATTCCCGC 0.982556 -121 CCCTCCATAACGGTTGCTTCAATAGATCAT 1 273 0 CGGTTGCTTC 0.950591 -28 TGATCGGGTTCCTTGTGTGTCGTGG 2 16 0 GGGTTCCTTG 0.95059 -15 GTCGACGAACCGGATCCCTCAGCTGTC 3 8 0 CGGATCCCTC 0.93441 -93 TCCGGTTCGTCGACGGCCGCGGTGGCCAGC 3 24 1 CGACGGCCGC 0.936162 -77 GACGGGTCGTGGCTGGCCACCGCGGCCGTC 3 35 0 GGCTGGCCAC 0.946356 -66 CTTCCCGGCGCGATGGCCTGGTGTGCGACG 3 61 0 CGATGGCCTG 0.965638 -40 TGCGGTCCGGGGCTTCCCGGCGCGATGGCC 3 73 0 GGCTTCCCGG 0.991478 -28 AGCCCCGGACCGCAACCTGGCC 3 89 1 CGCAACCTGG 0.87221 -12 ********** Masking position 7 Map Score: 8.79128 Number of sites scoring better than the average of aligned sites = 2855 Number in coding regions = 2623 Number in noncoding regions = 232 Number of orfs with sites within 600 bp upstream = 158 Fraction of orfs with sites within 600 bp upstream = 0.0253774 Motif number 2 CACACCCACGACACACAAGGAACCC 2 6 1 CCACGACACA 0.96851 -25 CCGCGGCCGTCGACGAACCGGATCCCTCAG 3 16 0 CGACGAACCG 0.987705 -85 CGGTGGCCAGCCACGACCCGTCGCACACCA 3 43 1 CCACGACCCG 0.998434 -58 GTCCGGGGCTTCCCGGCGCGATGGCCTGGT 3 69 0 TCCCGGCGCG 0.981519 -32 CGCCGGGAAGCCCCGGACCGCAACCTGGCC 3 81 1 CCCCGGACCG 0.996975 -20 ********** Masking position 5 Map Score: 5.32578 Number of sites scoring better than the average of aligned sites = 116 Number in coding regions = 112 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 3 AGCTCATTAGATCATTTGAACAGCATTATG 1 102 1 ATCATTTGAA 0.961873 -199 TCCTGCCGTACTCCTTTGATGTATAAGAGA 1 135 0 CTCCTTTGAT 0.95835 -166 ATACGCGGGAATCCTTTGAATATTTGTATT 1 174 0 ATCCTTTGAA 0.993531 -127 GACACAAAAAATCCTTTTTATTTTTCGATC 1 232 0 ATCCTTTTTA 0.914236 -69 GCGAATTATGATCTATTGAAGCAACCGTTA 1 266 1 ATCTATTGAA 0.917258 -35 ********** Masking position 6 Map Score: 3.07023 Number of sites scoring better than the average of aligned sites = 329 Number in coding regions = 298 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 4 TAGAGTATTTCATGGAGTAAGTTT 1 5 1 GTATTTCATG 0.94849 -296 ATGGAGTAAGTTTTTTTATGAAAGCGGAGG 1 22 1 TTTTTTTATG 0.796859 -279 AGCTGTTCAATTTCTTCTTGTTTTCCAGCT 1 76 0 TTTCTTCTTG 0.818651 -225 CTTTGAATATTTGTATTTTGGATTTGTCCT 1 161 0 TTGTATTTTG 0.858511 -140 GGATTCCCGCGTATATCTTGAATTAAAATT 1 190 1 GTATATCTTG 0.94849 -111 AAAATCCTTTTTATTTTTCGATCTTGGCAG 1 225 0 TTATTTTTCG 0.841524 -76 AAAATAAAAAGGATTTTTTGTGTCATTGGC 1 238 1 GGATTTTTTG 0.947249 -63 TGATCGGGTTCCTTGTGTGTCGTGG 2 16 0 GGGTTCCTTG 0.862482 -15 ********** Masking position 10 Map Score: 0.485067 Number of sites scoring better than the average of aligned sites = 1696 Number in coding regions = 1424 Number in noncoding regions = 272 Number of orfs with sites within 600 bp upstream = 266 Fraction of orfs with sites within 600 bp upstream = 0.0427241 Motif number 5 ********** No masking Map Score: -7.57849e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -7.57849e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -7.57849e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0