AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i034_bsub_mtub_100.orf -o034_bsub_mtub_100.ace -a/home/amcguire/genomes/ORF_bsub.txt -z/home/amcguire/genomes/bsub.fna -g0.55 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.55 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 yvgQ 25 similar to sulfite reductase #2 yvgR 170 similar to sulfite reductase Motif number 1 AAAAACTCCTTTCAAGTCAAA 1 2 0 TTCAAGTCAA 0.981462 -24 ACGGCTATGCTTCATGTAAATAGAAAAAAG 2 29 0 TTCATGTAAA 0.986796 -142 AATAGTTATCATCATGTAAATATATTTTAC 2 77 1 ATCATGTAAA 0.98023 -94 GAATACTAGGCTTAAGTAAAATATATTTAC 2 92 0 CTTAAGTAAA 0.9197 -79 AAGCCTAGTATTCCGGTAAAGTTCAATTAG 2 109 1 TTCCGGTAAA 0.98044 -62 TCCGGTAAAGTTCAATTAGATGCAATTTTC 2 120 1 TTCAATTAGA 0.91617 -51 ********** Masking position 7 Map Score: 6.60586 Number of sites scoring better than the average of aligned sites = 386 Number in coding regions = 327 Number in noncoding regions = 59 Number of orfs with sites within 600 bp upstream = 74 Fraction of orfs with sites within 600 bp upstream = 0.0118856 Motif number 2 TGACTTGAAAGGAGTTTTTCAAC 1 13 1 GGAGTTTTTC 0.990893 -13 AGAGAAGGGAGTCCTTCTCTTTTTTCT 2 8 1 GGAGTCCTTC 0.977598 -163 TTTATCATTAGGATTCTTAATAGTTATCAT 2 59 1 GGATTCTTAA 0.965411 -112 ********** Masking position 3 Map Score: 0.305657 Number of sites scoring better than the average of aligned sites = 107 Number in coding regions = 91 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 3 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0