AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i064_bsub_mtub_100.orf -o064_bsub_mtub_100.ace -a/home/amcguire/genomes/ORF_bsub.txt -z/home/amcguire/genomes/bsub.fna -g0.55 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.55 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 hisZ 250 histidyl-tRNA synthetase #2 hisD 99 hisD #3 hisI 126 hisI Motif number 1 TAAGATAACAGCGGAGGTGCTCGGGTTG 1 233 1 GCGGAGGTGC 0.938834 -18 GACCGGCAAAGAGGAGCCGCC 2 2 0 GAGGAGCCGC 0.609019 -98 GTGCAGTAGAAAGGACCGGCAAAGAGGAGC 2 15 0 AAGGACCGGC 0.959605 -85 GGGCGGCGGCGCGGTCACGTAG 2 88 0 GCGGCGGCGC 0.50596 -12 GCCCTAATGCGCGGCGCGGCGGTGGCGAAC 3 69 1 GCGGCGCGGC 0.506073 -58 ********** Masking position 4 Map Score: 8.09872 Number of sites scoring better than the average of aligned sites = 227 Number in coding regions = 209 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 2 CTTTATGTTTGGCATGCTATAATACAAATC 1 34 0 GGCATGCTAT 0.972813 -217 GGTCGAAGGAGGCAGCCGAAC 3 2 0 GGCAGCCGAA 0.994284 -125 GAATAACTAGGGTAGCCTAACCTATATTAG 3 36 1 GGTAGCCTAA 0.986673 -91 CGCGCATTAGGGCATCCTAATATAGGTTAG 3 52 0 GGCATCCTAA 0.994202 -75 ACCGTGACTTGGCTGGCTGACAC 3 114 1 GGCTGGCTGA 0.973204 -13 ********** Masking position 7 Map Score: 5.12254 Number of sites scoring better than the average of aligned sites = 186 Number in coding regions = 173 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 3 ATAATGAGGAGAAGGATATTTGAACTAAAA 1 110 1 GAAGGATATT 0.989765 -141 TTAACTTCAGTAAGGATATTTTTAGTTCAA 1 129 0 TAAGGATATT 0.960537 -122 GCAGATGAAAGAATGAAAATCAACGCTTAA 1 155 0 GAATGAAAAT 0.960537 -96 GTTATCTTATGAAGGAAAATTCCGAATCCT 1 212 0 GAAGGAAAAT 0.989765 -39 ********** Masking position 6 Map Score: 2.85288 Number of sites scoring better than the average of aligned sites = 107 Number in coding regions = 93 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 4 CTTTATCTCCTTGTTCTCTATTTG 1 1 1 CTTACTCTGT 0.975918 -250 TACGTAATATCTCAAATTCTTTATGTTTGGCATG 1 48 0 CTCATTCTAT 0.979952 -203 TATTACGTACCTTTAATACATTATTCATGATTTT 1 73 1 CTTATACTAT 0.97057 -178 TTCAAATATCCTTCTCCTCATTATGAAAAAATCA 1 100 0 CTTTCTCTAT 0.964717 -151 AAAATCAACGCTTAACTTCAGTAAGGATATTTTT 1 136 0 CTTATTCTAA 0.986235 -115 ATTCCGAATCCTTTAGTTCGCTAATATGATAATA 1 190 0 CTTATTCTAA 0.986234 -61 *** * *** *** Masking position 12 Map Score: 2.78784 Number of sites scoring better than the average of aligned sites = 61 Number in coding regions = 47 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 5 TAGAAAGGACCGGCAAAGAGGAGCCGCC 2 6 0 CGCAAGGGAG 0.830623 -94 GATATCTGACCGGTACAGTGCAGTAGAAAGGAC 2 29 0 CGTACGGCAG 0.734732 -71 GAATGGTCTACGTGACCGCGCCGCCGCCC 2 81 1 CGGACGGCCG 0.776527 -19 TAATGCGCGGCGCGGCGGTGGCGAACGTGTGGC 3 73 1 CGGGCGGGCG 0.522313 -54 GTCAAACCACCGTGACTTGGCTGGCTGACAC 3 106 1 CGGACTGCTG 0.986745 -21 ** *** * **** Masking position 10 Map Score: 1.79501 Number of sites scoring better than the average of aligned sites = 140 Number in coding regions = 135 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 6 CAGCGGAGGTGCTCGGGTTG 1 241 1 GCTCGGGTTG 0.990576 -10 TCCCAGAGCAGCTCAAGTCGATATCTGACC 2 51 0 GCTCAAGTCG 0.953703 -49 GACTTGAGCTGCTCTGGGAGAATGGTCTAC 2 62 1 GCTCTGGGAG 0.978624 -38 GCGGCGGCGCGGTCACGTAGACCATTCTCC 2 78 0 GGTCACGTAG 0.980417 -22 CACAGGAATAACTAGGGTAGCCTAACCTAT 3 31 1 ACTAGGGTAG 0.887307 -96 CAGCCAGCCAAGTCACGGTGGTTTGACGCC 3 103 0 AGTCACGGTG 0.907304 -24 ********** Masking position 3 Map Score: 0.435709 Number of sites scoring better than the average of aligned sites = 474 Number in coding regions = 420 Number in noncoding regions = 54 Number of orfs with sites within 600 bp upstream = 35 Fraction of orfs with sites within 600 bp upstream = 0.00562159 Motif number 7 ********** No masking Map Score: -6.51267e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -6.51267e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -6.51267e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0