AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i074_bsub_mtub_100.orf -o074_bsub_mtub_100.ace -a/home/amcguire/genomes/ORF_bsub.txt -z/home/amcguire/genomes/bsub.fna -g0.55 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.55 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 yusL 267 similar to 3-hydroxyacyl-CoA dehydrogenase Motif number 1 AAGCAGCCGTGGGAAGCAGC 1 1 1 AAGCAGCCGT 0.992684 -267 CCGTGGGAAGCAGCTGCATTATGATTGTCC 1 17 1 CAGCTGCATT 0.985651 -251 GACAAGTCAAAATCAGCAGTATAAAAAACA 1 54 0 AATCAGCAGT 0.983802 -214 TGTCCGTTTTCCGCCGCCGTAATGCTGAGT 1 80 1 CCGCCGCCGT 0.991291 -188 TGCCGGTCCGACTCAGCATTACGGCGGCGG 1 90 0 ACTCAGCATT 0.955887 -178 GTCGGACCGGCATCTCCCTTTACGCTCGCC 1 108 1 CATCTCCCTT 0.91934 -160 AATCCGTCTTCAGCGGCAGTCAGCGCGGCG 1 134 0 CAGCGGCAGT 0.989086 -134 AGAGAAAAAAAATCCGTCTTCAGCGGCAGT 1 144 0 AATCCGTCTT 0.84897 -124 ********** Masking position 10 Map Score: 10.6806 Number of sites scoring better than the average of aligned sites = 2242 Number in coding regions = 2020 Number in noncoding regions = 222 Number of orfs with sites within 600 bp upstream = 142 Fraction of orfs with sites within 600 bp upstream = 0.0228076 Motif number 2 AAAAAACATAACATGGGACAATCATAATGC 1 32 0 ACATGGGACA 0.907878 -236 ACGGCGGCGGAAAACGGACAAGTCAAAATC 1 70 0 AAAACGGACA 0.984375 -198 CCGTAATGCTGAGTCGGACCGGCATCTCCC 1 96 1 GAGTCGGACC 0.992734 -172 ACTGCCGCTGAAGACGGATTTTTTTTCTCT 1 144 1 AAGACGGATT 0.919322 -124 AAGCCTATAAAAGTCGGGCAACTTAAGCCC 1 195 0 AAGTCGGGCA 0.992198 -73 TTAGCTATTGAAGTCGAACCGGAAATCTTT 1 244 1 AAGTCGAACC 0.982896 -24 ********** Masking position 6 Map Score: 4.44683 Number of sites scoring better than the average of aligned sites = 642 Number in coding regions = 577 Number in noncoding regions = 65 Number of orfs with sites within 600 bp upstream = 48 Fraction of orfs with sites within 600 bp upstream = 0.0077096 Motif number 3 AGCAGTATAAAAAACATAACATGGGACAAT 1 40 0 AAAACATAAC 0.982564 -228 GGTACGAGAGAAAAAAAATCCGTCTTCAGC 1 150 0 AAAAAAAATC 0.963686 -118 GCTTCATACAAAAAAATAACAAATTAGCTA 1 221 1 AAAAAATAAC 0.985303 -47 CTTAAAAGATTTCCGGTTCGACT 1 255 0 AAAAGATTTC 0.956298 -13 ********** Masking position 6 Map Score: 2.01704 Number of sites scoring better than the average of aligned sites = 190 Number in coding regions = 141 Number in noncoding regions = 49 Number of orfs with sites within 600 bp upstream = 54 Fraction of orfs with sites within 600 bp upstream = 0.00867331 Motif number 4 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0