AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i109_bsub_mtub_300.orf -o109_bsub_mtub_300.ace -a/home/amcguire/genomes/ORF_bsub.txt -z/home/amcguire/genomes/bsub.fna -g0.55 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.55 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 ytkP 148 similar to cysteine synthase #2 subI 124 subI Motif number 1 TGTGCGGATAGAGGAACAGTGTATGAAAACA 1 61 1 GGGAACAGTG 0.996479 -88 ATAAACGTTTGTGCGAGAGTGTTTTCATACA 1 80 0 GGCGAGAGTG 0.977361 -69 ACATCAGACCGCGCACGGGTGGGGAGTCAGC 2 18 0 GGCACGGGTG 0.976648 -107 AAAGGCGATCGCTGAACATTGCAGGACTCAC 2 56 0 GTGAACATTG 0.952214 -69 TCCCGTAGCGGCGGAAAGGCGATCGCTGAAC 2 70 0 GGGAAAGGCG 0.98448 -55 TCCGCCGCTACGGGAACGTTGTCCAAAGTCC 2 86 1 CGGAACGTTG 0.992387 -39 ACCTTCCGGTGCGGGACTTTGGACAACGTTC 2 99 0 GGGGACTTTG 0.975604 -26 AAGTCCCGCACCGGAAGGTCGCCA 2 111 1 CGGAAGGTCG 0.982522 -14 * ********* Masking position 11 Map Score: 8.78005 Number of sites scoring better than the average of aligned sites = 738 Number in coding regions = 631 Number in noncoding regions = 107 Number of orfs with sites within 600 bp upstream = 72 Fraction of orfs with sites within 600 bp upstream = 0.0115644 Motif number 2 TGTTCCTCTATCCGCACAGCCTCTTTATTG 1 49 0 TCCGCACAGC 0.983313 -100 CACATCAGACCGCGCACGGGTGGGGAGTCA 2 20 0 CGCGCACGGG 0.670291 -105 GGACAACGTTCCCGTAGCGGCGGAAAGGCG 2 80 0 CCCGTAGCGG 0.723362 -45 TGTCCAAAGTCCCGCACCGGAAGGTCGCCA 2 105 1 CCCGCACCGG 0.671322 -20 ********** Masking position 6 Map Score: 5.0191 Number of sites scoring better than the average of aligned sites = 127 Number in coding regions = 116 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 3 GTTTTCATACACTGTTCCTCTATCCGCACA 1 61 0 ACTGTTCCTC 0.958381 -88 TGAGTCCTGCAATGTTCAGCGATCGCCTTT 2 57 1 AATGTTCAGC 0.957259 -68 TTCAGCGATCGCCTTTCCGCCGCTACGGGA 2 71 1 GCCTTTCCGC 0.977412 -54 GACTTTGGACAACGTTCCCGTAGCGGCGGA 2 86 0 AACGTTCCCG 0.979945 -39 AACGTTGTCCAAAGTCCCGCACCGGAAGGT 2 100 1 AAAGTCCCGC 0.968033 -25 TGGCGACCTTCCGGTGCGGGACTT 2 111 0 GACCTTCCGG 0.975909 -14 ********** Masking position 5 Map Score: 1.62351 Number of sites scoring better than the average of aligned sites = 1331 Number in coding regions = 1253 Number in noncoding regions = 78 Number of orfs with sites within 600 bp upstream = 74 Fraction of orfs with sites within 600 bp upstream = 0.0118856 Motif number 4 ATAATAGCTGTCAAAGAAGGGAGTGTCAGAC 1 13 0 TCAAAAAGGG 0.991768 -136 TCTTTATTGATAAAATAATAGCTGTCAAAGA 1 27 0 TAAAAAATAG 0.958891 -122 TATTATTTTATCAATAAAGAGGCTGTGCGGA 1 38 1 TCAATAAGAG 0.982678 -111 CCTTTCTGAATAAAACAAGTGTCATATAATA 1 121 0 TAAAAAAGTG 0.981328 -28 ***** ***** Masking position 7 Map Score: 1.14033 Number of sites scoring better than the average of aligned sites = 312 Number in coding regions = 248 Number in noncoding regions = 64 Number of orfs with sites within 600 bp upstream = 69 Fraction of orfs with sites within 600 bp upstream = 0.0110826 Motif number 5 ********** No masking Map Score: -2.81785e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.81785e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.81785e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0