AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i118_bsub_mtub_300.orf -o118_bsub_mtub_300.ace -a/home/amcguire/genomes/ORF_bsub.txt -z/home/amcguire/genomes/bsub.fna -g0.55 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.55 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 secF 125 protein-export membrane protein #2 yrvB 38 yrvB #3 yrzD 115 yrzD #4 secD 109 secD #5 Rv2588c 166 hypothetical protein Rv2588c Motif number 1 CGTCGGTTCCGGTCGGCCGGTTGCCGG 4 8 0 GGTCGGCCGG 0.992519 -102 TCGCGCAAGCGGCTCGTCGGTTCCGGTCGG 4 22 0 GGCTCGTCGG 0.997956 -88 GTCGCGCCGGGGCGCGTCGCGCAAGCGGCT 4 38 0 GGCGCGTCGC 0.988311 -72 GAGCCTACGTGTCGCGCCGGGGCGCGTCGC 4 48 0 GTCGCGCCGG 0.996005 -62 CTCCTCACCCGGCTCGCCGGTTCACATCGC 5 16 1 GGCTCGCCGG 0.999438 -151 CGTCCAGTCTGGCAGGCCGGAAACATCGGT 5 65 0 GGCAGGCCGG 0.997709 -102 CGGCCTGCCAGACTGGACGGGCACACTGGA 5 76 1 GACTGGACGG 0.956683 -91 CCAGGTGCGCGGCCCGCGGGTAGGCCTGGC 5 112 1 GGCCCGCGGG 0.996852 -55 ********** Masking position 6 Map Score: 21.0825 Number of sites scoring better than the average of aligned sites = 206 Number in coding regions = 197 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 2 TTTTCGACTAGATCAGCACCGT 1 2 0 GATCGCACCG 0.996189 -124 TCATAAGTTTGTTTAGCGCCGTTTTCGACTA 1 23 0 GTTTGCGCCG 0.93033 -103 CAGGTTGATTCGCACAGGTTTAAGGGA 2 7 1 GATTGCACAG 0.97946 -32 GCAACCGGCCGACCGGAACCGACGAGCCGCT 4 14 1 GACCGAACCG 0.990209 -96 CCGCTTGCGCGACGCGCCCCGGCGCGACACG 4 40 1 GACGGCCCCG 0.996183 -70 CTTTACCAGCGATGTGAACCGGCGAGCCGGG 5 23 0 GATGGAACCG 0.989948 -144 TGCCAGACTGGACGGGCACACTGGACTGTTA 5 81 1 GACGGCACAC 0.969719 -86 CTACCCGCGGGCCGCGCACCTGGTAACAGTC 5 104 0 GCCGGCACCT 0.984162 -63 CCGCGGGTAGGCCTGGCACCGTGATCGCAAT 5 125 1 GCCTGCACCG 0.996302 -42 **** ****** Masking position 9 Map Score: 16.3253 Number of sites scoring better than the average of aligned sites = 383 Number in coding regions = 362 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 3 GTGAAGTGACCAAGAAGGTCATGAAA 1 110 1 CAAGAAGGTC 0.899677 -16 CAGGTTGATTCGCACAGGTT 2 1 1 CAGGTTGATT 0.773233 -38 TATATGATTCCAGGTAGTTTGAGAAGGCAG 3 20 0 CAGGTAGTTT 0.915184 -96 TATTGTTTTTCAAGAAGACTTGTCATGCTT 3 77 0 CAAGAAGACT 0.829386 -39 CTCGTCGGTTCCGGTCGGCCGGTTGCCGG 4 10 0 CCGGTCGGCC 0.963908 -100 CCCGGCGCGACACGTAGGCTCTGTCGGGGG 4 57 1 CACGTAGGCT 0.979916 -53 CATCGGTCAGCAGATAGGCTTTACCAGCGA 5 42 0 CAGATAGGCT 0.961365 -125 CCCGTCCAGTCTGGCAGGCCGGAAACATCG 5 67 0 CTGGCAGGCC 0.954286 -100 GCGCGGCCCGCGGGTAGGCCTGGCACCGTG 5 118 1 CGGGTAGGCC 0.990152 -49 ********** Masking position 1 Map Score: 5.71841 Number of sites scoring better than the average of aligned sites = 799 Number in coding regions = 688 Number in noncoding regions = 111 Number of orfs with sites within 600 bp upstream = 65 Fraction of orfs with sites within 600 bp upstream = 0.0104401 Motif number 4 CATAAGTTTGTTTAGCGCCGTTTTCGACTA 1 23 0 TTTAGCGCCG 0.870171 -103 TTTATCAGCGTCTTTCAGCTTAATCGTGAC 1 76 0 TCTTTCAGCT 0.799941 -50 CTTCACCAAATTTATCAGCGTCTTTCAGCT 1 86 0 TTTATCAGCG 0.969153 -40 TTTTACCCCCTGCCTTCTCAA 3 2 1 TTTACCCCCT 0.969879 -114 GAATCAGTTTTCTACCCCCGACAGAGCCTA 4 71 0 TCTACCCCCG 0.990133 -39 GTTCCTTGTATCTCCTCGAGAATCAG 4 94 0 TGTATCTCCT 0.802323 -16 GCAGATAGGCTTTACCAGCGATGTGAACCG 5 33 0 TTTACCAGCG 0.980328 -134 GCTGGTAAAGCCTATCTGCTGACCGATGTT 5 44 1 CCTATCTGCT 0.896401 -123 CGGTGCCAGGCCTACCCGCGGGCCGCGCAC 5 116 0 CCTACCCGCG 0.983807 -51 ********** Masking position 3 Map Score: 7.05573 Number of sites scoring better than the average of aligned sites = 490 Number in coding regions = 422 Number in noncoding regions = 68 Number of orfs with sites within 600 bp upstream = 55 Fraction of orfs with sites within 600 bp upstream = 0.00883392 Motif number 5 GATCTAGTCGAAAACGGCGCTAAACAAACT 1 19 1 AAAACGGCGC 0.90364 -107 TTAATCGTGACAATTGGCTCATTTGTTGTG 1 57 0 CAATTGGCTC 0.879335 -69 CCGGCAACCGGCCGACCGGAACCG 4 5 1 CAACCGGCCG 0.973517 -105 GCGCGTCGCGCAAGCGGCTCGTCGGTTCCG 4 27 0 CAAGCGGCTC 0.992948 -83 TGCGCGACGCGCCCCGGCGCGACACGTAGG 4 45 1 GCCCCGGCGC 0.731642 -65 AGATCCTCCTCACCCGGCTCGCCGGTTCAC 5 11 1 CACCCGGCTC 0.889781 -156 GCCAGGCCTACCCGCGGGCCGCGCACCTGG 5 112 0 CCCGCGGGCC 0.959116 -55 ********** Masking position 6 Map Score: 4.59243 Number of sites scoring better than the average of aligned sites = 829 Number in coding regions = 751 Number in noncoding regions = 78 Number of orfs with sites within 600 bp upstream = 48 Fraction of orfs with sites within 600 bp upstream = 0.0077096 Motif number 6 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0