AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i185_bsub_mtub_300.orf -o185_bsub_mtub_300.ace -a/home/amcguire/genomes/ORF_bsub.txt -z/home/amcguire/genomes/bsub.fna -g0.55 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.55 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 ykvJ 300 similar to hypothetical proteins Motif number 1 TCTTGACAATAAAAAAGTCAGTCCCCGGTTC 1 47 0 AAAAAAGCAG 0.986183 -254 TTTTATTGTCAAGAAAAACATCATTATGGTA 1 64 1 AAGAAAACAT 0.962024 -237 GAAAAAATTGAAGAAAATCCGTGCGATATGC 1 108 1 AAGAAAACCG 0.990365 -193 CACCCTCTATAAAAAACTAAGGACGAGCTGT 1 156 1 AAAAAACAAG 0.920698 -145 AGAAAAACATAAAAAAGGCCGTATCCAAGGA 1 188 0 AAAAAAGCCG 0.991244 -113 GAAGGTGCTCTAGAAAAACATAAAAAAGGCC 1 199 0 TAGAAAACAT 0.902667 -102 AATTCACGCAAAAAAACACCTTTTTTCGGAA 1 227 0 AAAAAACCCT 0.984724 -74 TTCTCCGCAATAAAAACGCCGGCGAGAGACA 1 269 0 TAAAAACCCG 0.983706 -32 ******* *** Masking position 6 Map Score: 12.3705 Number of sites scoring better than the average of aligned sites = 1084 Number in coding regions = 827 Number in noncoding regions = 257 Number of orfs with sites within 600 bp upstream = 225 Fraction of orfs with sites within 600 bp upstream = 0.0361388 Motif number 2 ACTATAGAGCGATAATTGATCTAGGAACCGGGGA 1 23 1 GAAAGTCTAG 0.986998 -278 TGCGATATGCGGGAGAGGTTCTAGCTACACCCTC 1 129 1 GGAGGTCTAG 0.998531 -172 CTTAGTTTTTTATAGAGGGTGTAGCTAGAACCTC 1 143 0 TAAGGTGTAG 0.989235 -158 ACCTTTTTTCGGAAGGTGCTCTAGAAAAACATAA 1 207 0 GGAGGTCTAG 0.998531 -94 TTTTTTTGCGTGAATTAGCTGTAGCGATGTCTCT 1 242 1 TGATGTGTAG 0.981172 -59 ** ** * ***** Masking position 10 Map Score: 4.4345 Number of sites scoring better than the average of aligned sites = 22 Number in coding regions = 19 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 3 TGGTAAGATAGCAGAAGTGAAAAAATTGAA 1 90 1 GCAGAAGTGA 0.968831 -211 CGTGCGATATGCGGGAGAGGTTCTAGCTAC 1 127 1 GCGGGAGAGG 0.996428 -174 GCGTGAATTAGCTGTAGCGATGTCTCTCGC 1 249 1 GCTGTAGCGA 0.962854 -52 CAATAAAAACGCCGGCGAGAGACATCGCTA 1 263 0 GCCGGCGAGA 0.991576 -38 TTATTGCGGAGAAGGAGAGGAATC 1 287 1 GAAGGAGAGG 0.984748 -14 ********** Masking position 4 Map Score: 2.69312 Number of sites scoring better than the average of aligned sites = 514 Number in coding regions = 458 Number in noncoding regions = 56 Number of orfs with sites within 600 bp upstream = 47 Fraction of orfs with sites within 600 bp upstream = 0.00754899 Motif number 4 GGGACTGACTTTTTTATTGTCAAGAAAAAC 1 53 1 TTTTTATTGT 0.886307 -248 TCCTTAGTTTTTTATAGAGGGTGTAGCTAG 1 149 0 TTTATAGAGG 0.893542 -152 GGATACGGCCTTTTTTATGTTTTTCTAGAG 1 193 1 TTTTTTATGT 0.891874 -108 AAAAAAACACCTTTTTTCGGAAGGTGCTCT 1 219 0 CTTTTTTCGG 0.9496 -82 AAAAAGGTGTTTTTTTGCGTGAATTAGCTG 1 233 1 TTTTTTGCGT 0.986638 -68 CGCCGGCGTTTTTATTGCGGAGAAGGAGAG 1 276 1 TTTATTGCGG 0.984185 -25 ********** Masking position 5 Map Score: 2.69605 Number of sites scoring better than the average of aligned sites = 1342 Number in coding regions = 1104 Number in noncoding regions = 238 Number of orfs with sites within 600 bp upstream = 231 Fraction of orfs with sites within 600 bp upstream = 0.0371025 Motif number 5 TCCTAGATCAATTATCGCTCTATAGTGACG 1 19 0 ATTATCGCTC 0.941524 -282 ACCTCTCCCGCATATCGCACGGATTTTCTT 1 118 0 CATATCGCAC 0.95978 -183 CGTATCCAAGGATACAGCTCGTCCTTAGTT 1 170 0 GATACAGCTC 0.976721 -131 TAGCTGTAGCGATGTCTCTCGCCGGCGTTT 1 257 1 GATGTCTCTC 0.981606 -44 GATTCCTCTCCTTCTCCGCA 1 291 0 GATTCCTCTC 0.975446 -10 ********** Masking position 3 Map Score: 0.853103 Number of sites scoring better than the average of aligned sites = 567 Number in coding regions = 515 Number in noncoding regions = 52 Number of orfs with sites within 600 bp upstream = 42 Fraction of orfs with sites within 600 bp upstream = 0.0067459 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0