AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i217_bsub_mtub_100.orf -o217_bsub_mtub_100.ace -a/home/amcguire/genomes/ORF_bsub.txt -z/home/amcguire/genomes/bsub.fna -g0.55 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.55 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 spoIIIJ 144 alternate gene name: spo0J87 #2 rpmH 217 ribosomal protein L34 #3 rpmH 300 rpmH Motif number 1 TTATGACACCTCCCTCGAGGAATAGCTGT 2 199 0 ACCCCCCGAG 0.931393 -19 ACACTCACAAAGAACCCACCACAACGCAAAAC 3 11 0 AGACCCCCAC 0.980632 -290 TCCGTACACCCGAGACCGCCACACTCACAAAG 3 31 0 CGAACCCCAC 0.946972 -270 AAGCTGCTCACCATCCGTACACCCGAGACCGC 3 44 0 CCACCGACAC 0.96324 -257 CAAACCTCGCCCACCCGGCAACCGCTTCAGGG 3 89 0 CCACCGCAAC 0.980933 -212 AGGGTACTTACGCGCCTTCGCCTGGTCAAACC 3 115 0 CGCCCTCGCC 0.971553 -186 TAAGTACCCTCGAACAGTCGCCCGAAAGTCGG 3 137 1 CGACAGCGCC 0.92303 -164 AGGTCGCAGCCGCATCGCCGACTTTCGGGCGA 3 154 0 CGCTCGCGAC 0.978936 -147 GTCCAGGGACCGCGCCGGCCAGCAGCGAAAAC 3 192 1 CGCCCGCCAG 0.943274 -109 AGCAGCGAAAACCACCTCCGACTGTCCCGCGG 3 212 1 ACCCCTCGAC 0.961955 -89 GGCAACATCACCATCCGGCCACTCACTGCCTT 3 258 0 CCACCGCCAC 0.997002 -43 *** *** **** Masking position 6 Map Score: 13.1686 Number of sites scoring better than the average of aligned sites = 808 Number in coding regions = 738 Number in noncoding regions = 70 Number of orfs with sites within 600 bp upstream = 39 Fraction of orfs with sites within 600 bp upstream = 0.00626405 Motif number 2 GCTTTTAAAAGTTGTAAGAAAGCAGTGGTGA 1 14 0 GTTGAAGAAA 0.990804 -131 TCCTATTATGGTTGCAAGAAATAAAAGCACT 2 114 1 GTTGAAGAAA 0.99083 -104 CCCTCGAACAGTCGCCCGAAAGTCGGCGATG 3 143 1 GTCGCCGAAA 0.959476 -158 GGCCAATCGAGTTGGAAGGCAGTGAGTGGCC 3 243 1 GTTGAAGGCA 0.981329 -58 GGATGGTGATGTTGCCAGACATAGCGAGGAG 3 274 1 GTTGCAGACA 0.992123 -27 **** ****** Masking position 2 Map Score: 3.90052 Number of sites scoring better than the average of aligned sites = 42 Number in coding regions = 34 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 3 TGCCCGCTAAGCTGCTCACCATCCGTACAC 3 54 0 GCTGCTCACC 0.983222 -247 TTCAGGGCATCCTGCCCGCTAAGCTGCTCA 3 66 0 CCTGCCCGCT 0.98129 -235 CTGGTCAAACCTCGCCCACCCGGCAACCGC 3 96 0 CTCGCCCACC 0.968295 -205 TTCGAGGGTACTTACGCGCCTTCGCCTGGT 3 121 0 CTTACGCGCC 0.934585 -180 GGTGGTTTTCGCTGCTGGCCGGCGCGGTCC 3 198 0 GCTGCTGGCC 0.982748 -103 CTCCGACTGTCCCGCGGGCCAATCGAGTTG 3 227 1 CCCGCGGGCC 0.989672 -74 TCACCATCCGGCCACTCACTGCCTTCCAAC 3 253 0 GCCACTCACT 0.855095 -48 ********** Masking position 5 Map Score: 4.78342 Number of sites scoring better than the average of aligned sites = 1069 Number in coding regions = 987 Number in noncoding regions = 82 Number of orfs with sites within 600 bp upstream = 65 Fraction of orfs with sites within 600 bp upstream = 0.0104401 Motif number 4 ACTTTTAAAAGCGCTTCCTTTCTGGTTGATC 1 33 1 GCGTTCCTTT 0.94245 -112 TATTATATTTGCGTTACCTATTCATTGTCAA 2 152 0 GCGTACCTAT 0.801591 -66 GTCTTTAACAGCTATTCCTCGAGGGAGGTGT 2 192 1 GCTTTCCTCG 0.969481 -26 TGTGAGTGTGGCGGTCTCGGGTGTACGGATG 3 34 1 GCGTCTCGGG 0.901106 -267 ATGCCCTGAAGCGGTTGCCGGGTGGGCGAGG 3 86 1 GCGTTGCCGG 0.973329 -215 CGACTTTCGGGCGACTGTTCGAGGGTACTTA 3 137 0 GCGCTGTTCG 0.88359 -164 GCTGGCCGGCGCGGTCCCTGGACTAATCCAG 3 184 0 GCGTCCCTGG 0.994803 -117 GGGCGTCTCCTCGCTATGTCTGG 3 288 0 GCGCTCCTCG 0.99383 -13 *** ******* Masking position 2 Map Score: 3.02237 Number of sites scoring better than the average of aligned sites = 548 Number in coding regions = 482 Number in noncoding regions = 66 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 5 GTGATTTTAGGGGCAAATTGTTTGAATTTG 2 21 1 GGGCAAATTG 0.92035 -197 AAATAAGGTTTCGAAAGTTGAAAAGGTATG 2 81 1 TCGAAAGTTG 0.844391 -137 TAAGTACCCTCGAACAGTCGCCCGAAAGTC 3 137 1 CGAACAGTCG 0.951113 -164 GAACAGTCGCCCGAAAGTCGGCGATGCGGC 3 148 1 CCGAAAGTCG 0.977675 -153 ATTGGCCCGCGGGACAGTCGGAGGTGGTTT 3 220 0 GGGACAGTCG 0.994814 -81 ACTGTCCCGCGGGCCAATCGAGTTGGAAGG 3 232 1 GGGCCAATCG 0.981736 -69 ********** Masking position 6 Map Score: 2.20218 Number of sites scoring better than the average of aligned sites = 377 Number in coding regions = 360 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 6 ********** No masking Map Score: -1.42576e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.42576e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -1.42576e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0