AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i240_bsub_mtub_100.orf -o240_bsub_mtub_100.ace -a/home/amcguire/genomes/ORF_bsub.txt -z/home/amcguire/genomes/bsub.fna -g0.55 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.55 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 lytS 166 two-component sensor histidine kinase Motif number 1 CAAAAGGCTCATGTTTTATTTTACAATAGA 1 47 1 ATGTTTTATT 0.972173 -120 CTTGTGAAATATGTTTTCAGACGATTTTAA 1 84 1 ATGTTTTCAG 0.982554 -83 TTGCGGCTGACTGTTTTTTTAAAATCGTCT 1 102 0 CTGTTTTTTT 0.974172 -65 TCATTCTAGCATGTTTTCGTTTTGCGGCTG 1 123 0 ATGTTTTCGT 0.990784 -44 CCTGTTCTTTCCGTTTTCATTCTAGCATGT 1 139 0 CCGTTTTCAT 0.984803 -28 ********** Masking position 5 Map Score: 5.83853 Number of sites scoring better than the average of aligned sites = 662 Number in coding regions = 582 Number in noncoding regions = 80 Number of orfs with sites within 600 bp upstream = 91 Fraction of orfs with sites within 600 bp upstream = 0.0146161 Motif number 2 CTTTTATCTATTGTAAAATAAAACATGAGC 1 53 0 TTGTAAAATA 0.992251 -114 GATAAAAGCCTTGTGAAATATGTTTTCAGA 1 75 1 TTGTGAAATA 0.990891 -92 CTGACTGTTTTTTTAAAATCGTCTGAAAAC 1 96 0 TTTTAAAATC 0.976395 -71 ********** Masking position 6 Map Score: 2.25503 Number of sites scoring better than the average of aligned sites = 105 Number in coding regions = 78 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 3 AGCCTTTTGGCAGAAAGATTTGAATCTGAA 1 26 0 CAGAAAGATT 0.986733 -141 ATCTTTCTGCCAAAAGGCTCATGTTTTATT 1 37 1 CAAAAGGCTC 0.990187 -130 AAACATATTTCACAAGGCTTTTATCTATTG 1 70 0 CACAAGGCTT 0.989763 -97 AGAATGAAAACGGAAAGAACAGGTGACATG 1 146 1 CGGAAAGAAC 0.963913 -21 ********** Masking position 5 Map Score: 1.07803 Number of sites scoring better than the average of aligned sites = 543 Number in coding regions = 506 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 37 Fraction of orfs with sites within 600 bp upstream = 0.00594282 Motif number 4 ********** No masking Map Score: -2.8889e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.8889e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.8889e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0