AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i240_bsub_mtub_300.orf -o240_bsub_mtub_300.ace -a/home/amcguire/genomes/ORF_bsub.txt -z/home/amcguire/genomes/bsub.fna -g0.55 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.55 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 lytS 166 two-component sensor histidine kinase Motif number 1 CAAAAGGCTCATGTTTTATTTTACAATAGA 1 47 1 ATGTTTTATT 0.974074 -120 CTTGTGAAATATGTTTTCAGACGATTTTAA 1 84 1 ATGTTTTCAG 0.983512 -83 TTGCGGCTGACTGTTTTTTTAAAATCGTCT 1 102 0 CTGTTTTTTT 0.975939 -65 TCATTCTAGCATGTTTTCGTTTTGCGGCTG 1 123 0 ATGTTTTCGT 0.99132 -44 CCTGTTCTTTCCGTTTTCATTCTAGCATGT 1 139 0 CCGTTTTCAT 0.985767 -28 ********** Masking position 5 Map Score: 5.83853 Number of sites scoring better than the average of aligned sites = 662 Number in coding regions = 582 Number in noncoding regions = 80 Number of orfs with sites within 600 bp upstream = 91 Fraction of orfs with sites within 600 bp upstream = 0.0146161 Motif number 2 GCTCATGTTTTATTTTACAATAGATAAAAG 1 53 1 TATTTTACAA 0.991929 -114 TCTGAAAACATATTTCACAAGGCTTTTATC 1 75 0 TATTTCACAA 0.990504 -92 GTTTTCAGACGATTTTAAAAAAACAGTCAG 1 96 1 GATTTTAAAA 0.97533 -71 ********** Masking position 7 Map Score: 2.25503 Number of sites scoring better than the average of aligned sites = 105 Number in coding regions = 78 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 3 TCAGATTCAAATCTTTCTGCCAAAAGGCTC 1 27 1 ATCTTTCTGC 0.992867 -140 CTAGCATGTTTTCGTTTTGCGGCTGACTGT 1 118 0 TTCGTTTTGC 0.986952 -49 ATGTCACCTGTTCTTTCCGTTTTCATTCTA 1 145 0 TTCTTTCCGT 0.986952 -22 ********** Masking position 5 Map Score: 0.290996 Number of sites scoring better than the average of aligned sites = 362 Number in coding regions = 329 Number in noncoding regions = 33 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 4 ********** No masking Map Score: -2.8889e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.8889e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.8889e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0