AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i288_bsub_mtub_100.orf -o288_bsub_mtub_100.ace -a/home/amcguire/genomes/ORF_bsub.txt -z/home/amcguire/genomes/bsub.fna -g0.55 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.55 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 moxR 138 moxR Motif number 1 TGTGATTTGCCGGGCACCACCGCGGCGTCG 1 17 1 CGGGCACCAC 0.99732 -122 GGCACCACCGCGGCGTCGACGGAATCCAGG 1 29 1 CGGCGTCGAC 0.996176 -110 TAGTTGAACGCGGGCGCGTCGCTGCCCCGC 1 69 1 CGGGCGCGTC 0.997462 -70 CGTCGCTGCCCCGCGACGTTGGTCATGTCG 1 85 1 CCGCGACGTT 0.973785 -54 GACACGACTGCCGACATGACCAACGTCGCG 1 96 0 CCGACATGAC 0.988469 -43 ACAGCTCAATCGGACACGACTGCCGACATG 1 108 0 CGGACACGAC 0.999058 -31 ********** Masking position 3 Map Score: 11.9424 Number of sites scoring better than the average of aligned sites = 420 Number in coding regions = 392 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 2 ATTTGCCGGGCACCACCGCGGCGTCGACGG 1 21 1 CACCACCGCG 0.99409 -118 GCCTGGAATAGTTGAACGCGGGCGCGTCGC 1 61 1 GTTGAACGCG 0.936508 -78 CGTCGCGGGGCAGCGACGCGCCCGCGTTCA 1 73 0 CAGCGACGCG 0.981652 -66 CTGCCGACATGACCAACGTCGCGGGGCAGC 1 89 0 GACCAACGTC 0.963277 -50 CTCAATCGGACACGACTGCCGACATGACCA 1 104 0 CACGACTGCC 0.978106 -35 CAAAATCCTCCACAGCTCAATCGGACA 1 122 0 CTCCACAGCT 0.955347 -17 ********** Masking position 8 Map Score: 3.61907 Number of sites scoring better than the average of aligned sites = 1362 Number in coding regions = 1261 Number in noncoding regions = 101 Number of orfs with sites within 600 bp upstream = 66 Fraction of orfs with sites within 600 bp upstream = 0.0106007 Motif number 3 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0