AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i304_bsub_mtub_300.orf -o304_bsub_mtub_300.ace -a/home/amcguire/genomes/ORF_bsub.txt -z/home/amcguire/genomes/bsub.fna -g0.55 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.55 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 fadE7 35 fadE7 #2 Rv3272 100 hypothetical protein Rv3272 Motif number 1 GCCGCGAGGCTACCGGGCCG 1 1 1 GCCGCGAGGC 0.501073 -35 ACTCAATACTGCCCCGGCCCGGTAGCCTCG 1 15 0 GCCCCGGCCC 0.612558 -21 GGCAAGACATGCCGGGCGGTCGCCGCGGCG 2 26 1 GCCGGGCGGT 0.530934 -75 CCGGGCGGTCGCCGCGGCGTCGCGAACCCG 2 37 1 GCCGCGGCGT 0.612991 -64 CAGGGAGGATGCCGCACGCCAGGGAAGGTC 2 74 1 GCCGCACGCC 0.530957 -27 ********** Masking position 3 Map Score: 12.8329 Number of sites scoring better than the average of aligned sites = 195 Number in coding regions = 180 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 GCCGCGAGGCTACCGGGCCGGGG 1 4 1 GCGAGGCTAC 0.983259 -32 CGAGGCTACCGGGCCGGGGCAGTATTGAGT 1 15 1 GGGCCGGGGC 0.764858 -21 AAGACATGCCGGGCGGTCGCCGCGGCGTCG 2 29 1 GGGCGGTCGC 0.766668 -72 ATACGGGTTCGCGACGCCGCGGCGACCGCC 2 40 0 GCGACGCCGC 0.508705 -61 GTATGGTTCAGGGAGGATGCCGCACGCCAG 2 66 1 GGGAGGATGC 0.991411 -35 CGCACGCCAGGGAAGGTCACCACCG 2 86 1 GGAAGGTCAC 0.967243 -15 ********** Masking position 6 Map Score: 12.6897 Number of sites scoring better than the average of aligned sites = 430 Number in coding regions = 364 Number in noncoding regions = 66 Number of orfs with sites within 600 bp upstream = 37 Fraction of orfs with sites within 600 bp upstream = 0.00594282 Motif number 3 ATACTGCCCCGGCCCGGTAGCCTCGCGGC 1 10 0 GGCCCGGTAG 0.761462 -26 CCGCGGCGACCGCCCGGCATGTCTTGCCTC 2 24 0 CGCCCGGCAT 0.759688 -77 GCCGGGCGGTCGCCGCGGCGTCGCGAACCC 2 36 1 CGCCGCGGCG 0.499972 -65 AACCCGTATGGTTCAGGGAGGATGCCGCAC 2 61 1 GTTCAGGGAG 0.917804 -40 GGATGCCGCACGCCAGGGAAGGTCACCACC 2 80 1 CGCCAGGGAA 0.761331 -21 ********** Masking position 4 Map Score: 4.78779 Number of sites scoring better than the average of aligned sites = 515 Number in coding regions = 476 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 4 ********** No masking Map Score: -2.03625e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.03625e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.03625e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0