AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i339_bsub_mtub_100.orf -o339_bsub_mtub_100.ace -a/home/amcguire/genomes/ORF_bsub.txt -z/home/amcguire/genomes/bsub.fna -g0.55 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.55 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 ykrW 196 similar to ribulose-bisphosphate carboxylase Motif number 1 CGGGCTCGTCCCTCTGCCTGCTCTTGATAAGA 1 50 0 CTCTCCTGCT 0.99618 -147 GGTTGCCGGGCTTCATCGGGCTCGTCCCTCTG 1 66 0 CTCACGGGCT 0.997505 -131 CGATGAAGCCCGGCAACCGACTTATAAAGCAC 1 80 1 CGCACCGACT 0.994647 -117 CTGCAAGAATTAGCACCGTGCTTTATAAGTCG 1 97 0 TGCACGTGCT 0.984092 -100 CTAATTCTTGCAGCTAGCGGCTGAGAGATAAG 1 116 1 CGCTGCGGCT 0.994569 -81 CAAAAAACCTCTTCAAACTGCAATCGCGTCTA 1 173 0 CTCAACTGCA 0.958336 -24 * *** ****** Masking position 4 Map Score: 6.79381 Number of sites scoring better than the average of aligned sites = 1188 Number in coding regions = 1120 Number in noncoding regions = 68 Number of orfs with sites within 600 bp upstream = 56 Fraction of orfs with sites within 600 bp upstream = 0.00899454 Motif number 2 TTATTTTGAATTATCCCATCG 1 2 0 TTATCCCATC 0.977635 -195 AAAATCTATATTTTCTTATCAAGAGCAGGC 1 37 1 TTTTCTTATC 0.958469 -160 TTTCTCGTCCGAATCTTATCTCTCAGCCGC 1 132 0 GAATCTTATC 0.972375 -65 AAGAGGTTTCGTTTCTCGTCCGAATCTTAT 1 143 0 GTTTCTCGTC 0.988584 -54 CTTCAAACTGCAATCGCGTCTAAAGAGGTT 1 165 0 CAATCGCGTC 0.965083 -32 ********** Masking position 4 Map Score: 1.64215 Number of sites scoring better than the average of aligned sites = 521 Number in coding regions = 469 Number in noncoding regions = 52 Number of orfs with sites within 600 bp upstream = 40 Fraction of orfs with sites within 600 bp upstream = 0.00642467 Motif number 3 ATCGCGTCTAAAGAGGTTTCGTTTCTCGTC 1 153 0 AAGAGGTTTC 0.994362 -44 TTGCAGTTTGAAGAGGTTTTTTGAT 1 182 1 AAGAGGTTTT 0.977344 -15 ********** Masking position 4 Map Score: 1.032 Number of sites scoring better than the average of aligned sites = 14 Number in coding regions = 12 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 ********** No masking Map Score: 3.50598e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 3.50598e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 3.50598e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0