AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i348_bsub_mtub_100.orf -o348_bsub_mtub_100.ace -a/home/amcguire/genomes/ORF_bsub.txt -z/home/amcguire/genomes/bsub.fna -g0.55 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.55 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 yviE 46 yviE #2 flgM 80 anti-sigma factor repressor of sigma-D-dependent transcription #3 yvyF 73 alternate gene name: yviB; similar to flagellar protein #4 comFB 59 late competence gene #5 comFA 105 late competence protein Motif number 1 TAGGAGTTCGCTTTTTTTATAGTTCAGGAG 1 19 1 CTTTTTTTAT 0.985338 -28 ATGATTCTGTTTTTATGCCGATATAA 3 7 1 CTGTTTTTAT 0.974395 -67 TTTTTTTCTCCTTATTAGATAATATGCCTG 3 53 0 CTTATTAGAT 0.895005 -21 CTTTTTTTCTCCTTATTAGA 3 64 0 CTTTTTTTCT 0.946949 -10 CCATTATTTGAAAACGTGGTAC 4 3 1 ATTATTTGAA 0.854103 -57 TAGAGCGGAGATTTTTTTATATTCTTATTT 5 28 1 ATTTTTTTAT 0.93891 -78 TTTTTATATTCTTATTTTAATAGTTGGACA 5 41 1 CTTATTTTAA 0.963117 -65 TTCAGGCATACTGTTTCGAAAGGAGGCGTG 5 82 1 CTGTTTCGAA 0.877368 -24 ********** Masking position 5 Map Score: 7.96382 Number of sites scoring better than the average of aligned sites = 2067 Number in coding regions = 1558 Number in noncoding regions = 509 Number of orfs with sites within 600 bp upstream = 476 Fraction of orfs with sites within 600 bp upstream = 0.0764536 Motif number 2 GCGGCTCTTAGGAGTTCGCTTTTTTTATAG 1 10 1 AGGAGTCGCT 0.984801 -37 AGGATTCCTCTCGCTTTCCGT 2 70 0 AGGATTCTCT 0.98127 -11 AAATTGACACAGGCATATTATCTAATAAGGA 3 44 1 AGGCATTTAT 0.963773 -30 ATATTCATTCAGGCATACTGTTTCGAAAGGA 5 75 1 AGGCATCTGT 0.991504 -31 TTTCGAAAGGAGGCGTGCTAT 5 95 1 AGGCGTCTAT 0.995366 -11 ****** **** Masking position 6 Map Score: 2.90131 Number of sites scoring better than the average of aligned sites = 138 Number in coding regions = 118 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 3 GTCAATTTCTAGTGATTATATCGGCATAAAA 3 21 0 ATGATTATAT 0.905864 -53 GCTCCTCATCATCGGTTATATGAGTATACTG 4 32 0 ACGGTTATAT 0.979926 -28 CCGCTCTAAAAACGGAGATTTGGCC 5 5 0 ACGGAGATTT 0.990849 -101 CCGTTTTTAGAGCGGAGATTTTTTTATATTC 5 21 1 ACGGAGATTT 0.990852 -85 AGTATGCCTGAATGAATATTTTCTGTCCAAC 5 63 0 ATGAATATTT 0.951621 -43 * ********* Masking position 8 Map Score: 2.47462 Number of sites scoring better than the average of aligned sites = 376 Number in coding regions = 343 Number in noncoding regions = 33 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 4 CTTTTATCGACTGCGTTTTCAGTTAGTTTAG 2 15 0 CTCGTTTTCA 0.996485 -66 ATGATTCTGTTTTTATGCCGATATA 3 5 1 TTTGTTTTTA 0.920707 -69 GTATACTGTACCACGTTTTCAAATAATGG 4 9 0 CCCGTTTTCA 0.994023 -51 GGCCAAATCTCCGTTTTTAGAGCGGAGAT 5 9 1 CTCGTTTTTA 0.994574 -97 ** ******** Masking position 6 Map Score: 3.08422 Number of sites scoring better than the average of aligned sites = 91 Number in coding regions = 82 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 5 CACTCTACCTCCTGAACTATAAAAAAAGCG 1 27 0 CCTGAACTAT 0.989813 -20 TTCCCTAAACTAACTGAAAACGC 2 4 1 CCTAAACTAA 0.984331 -77 AAACAGTATGCCTGAATGAATATTTTCTGT 5 68 0 CCTGAATGAA 0.981413 -38 ********** Masking position 5 Map Score: 0.097356 Number of sites scoring better than the average of aligned sites = 42 Number in coding regions = 41 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 6 ********** No masking Map Score: -6.29951e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -6.29951e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -6.29951e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0