AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i004_synecho_ctra_100.orf -o004_synecho_ctra_100.ace -a/home/amcguire/genomes/ORF_synecho.txt -z/home/amcguire/genomes/synecho.fna -g0.46 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY24958 106 Synechocystis #2 RCY23085 96 Synechocystis #3 RCY06919 231 Synechocystis Motif number 1 AGGTTTGACTTTAAACTGAGGCTAACCGCT 1 61 0 TTAAACTGAG 0.921208 -46 AAATTAAATTGAGATGACGAAGA 1 94 0 TTAAATTGAG 0.900212 -13 TTGTAAACTTCGCCATTGATTAGGCGGTAG 2 45 1 CGCCATTGAT 0.928266 -52 TTAATTTTGTTTCCATTGAGCTACAGACTA 2 72 0 TTCCATTGAG 0.973133 -25 TACCAATTCTTGCCGCCGAGGAAATCAGTG 3 111 1 TGCCGCCGAG 0.949361 -121 AGAGGTTATGTTCCACTGATTTCCTCGGCG 3 124 0 TTCCACTGAT 0.97717 -108 AACCTCTCCCTGCCATTGGGGGTATGCCCG 3 147 1 TGCCATTGGG 0.980513 -85 ********** Masking position 8 Map Score: 5.15767 Number of sites scoring better than the average of aligned sites = 969 Number in coding regions = 884 Number in noncoding regions = 85 Number of orfs with sites within 600 bp upstream = 98 Fraction of orfs with sites within 600 bp upstream = 0.0157404 Motif number 2 TGACATAAAAATCTTTCCTTGGGATCTTG 1 9 1 AAATCTTCCT 0.981579 -98 TGGGATCTTGAAGATTTTCCGATACGCTATT 1 30 1 AAGATTTCCG 0.9616 -77 CCTCAGTTTAAAGTCAAACCTCCATCTTCGT 1 70 1 AAGTCAACCT 0.784974 -37 TTTACGTCCGAAATTTCGCCGAACATC 2 7 0 AAATTTCCCG 0.937244 -90 AAGAAGATAAAAGACATCCCTGATCATAGCA 3 20 1 AAGACATCCT 0.935763 -212 CGGGTAAATTAAGTCTGACCTTGCTATGATC 3 41 0 AAGTCTGCCT 0.844848 -191 ATTCAACCAAAGATTTGTCCGGGTAAATTAA 3 60 0 AGATTTGCCG 0.878613 -172 GTCGATTACCAATTCTTGCCGCCGAGGAAAT 3 105 1 AATTCTTCCG 0.97107 -127 ******* *** Masking position 1 Map Score: 4.47079 Number of sites scoring better than the average of aligned sites = 733 Number in coding regions = 620 Number in noncoding regions = 113 Number of orfs with sites within 600 bp upstream = 131 Fraction of orfs with sites within 600 bp upstream = 0.0210408 Motif number 3 TCAAGATCCCAAGGAAAGATTTTTATGTCA 1 10 0 AGGAAAGATT 0.934679 -97 TTAAATTGAGATGACGAAGATGGAGGTTTGA 1 83 0 AGACGAAGAT 0.912212 -24 GATGTTCGGCGAAATTTCGGACGTAA 2 6 1 TGGCGAAATT 0.960356 -91 CGCCTAATCAATGGCGAAGTTTACAAGTTTA 2 40 0 AGGCGAAGTT 0.992084 -57 GATTTCCTCGGCGGCAAGAATTGGTAATCGA 3 106 0 GGGCAAGAAT 0.910907 -126 CCCCAATGGCAGGGAGAGGTTATGTTCCACT 3 137 0 AGGAGAGGTT 0.985204 -95 * ********* Masking position 7 Map Score: 0.87617 Number of sites scoring better than the average of aligned sites = 645 Number in coding regions = 558 Number in noncoding regions = 87 Number of orfs with sites within 600 bp upstream = 103 Fraction of orfs with sites within 600 bp upstream = 0.0165435 Motif number 4 ACGCTATTAGCGGTTAGCCTCAGTTTAAAG 1 53 1 CGGTTAGCCT 0.904764 -54 ACGAAGATGGAGGTTTGACTTTAAACTGAG 1 71 0 AGGTTTGACT 0.981304 -36 TGCTATGATCAGGGATGTCTTTTATCTTCT 3 21 0 AGGGATGTCT 0.950278 -211 GATCATAGCAAGGTCAGACTTAATTTACCC 3 41 1 AGGTCAGACT 0.935586 -191 ATTCAACCAAAGATTTGTCCGGGTAAATTA 3 61 0 AGATTTGTCC 0.88025 -171 CTGCCATTGGGGGTATGCCCGCGCCTTGAT 3 156 1 GGGTATGCCC 0.927251 -76 TGGGGAAGCGATGACCTGAATTCAAT 3 216 0 AGCGATGACC 0.913979 -16 ********** Masking position 7 Map Score: 1.40694 Number of sites scoring better than the average of aligned sites = 1118 Number in coding regions = 985 Number in noncoding regions = 133 Number of orfs with sites within 600 bp upstream = 155 Fraction of orfs with sites within 600 bp upstream = 0.0248956 Motif number 5 ********** No masking Map Score: -4.02005e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -4.02005e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -4.02005e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0