AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i009_synecho_ctra_300.orf -o009_synecho_ctra_300.ace -a/home/amcguire/genomes/ORF_synecho.txt -z/home/amcguire/genomes/synecho.fna -g0.46 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCT00585 18 Chlamydia_trachomatis #2 RCT00586 154 Chlamydia_trachomatis #3 RCT00587 300 Chlamydia_trachomatis Motif number 1 TCTTGCTGCCTACAAGGA 1 6 1 CTGCCTACAA 0.984842 -13 GATCAGATTTAGGCCTAGAAAAACCCCTCC 2 29 0 AGGCCTAGAA 0.990282 -126 TTATCTAAAAATCCCTAGATTTCTTGTTTT 2 72 1 ATCCCTAGAT 0.946828 -83 AAGGAAAAATCGGCCTAGAAAGTGACAGTT 2 112 0 CGGCCTAGAA 0.988242 -43 CCCAAACTATATCCCTACAAATCGCGAATT 3 93 0 ATCCCTACAA 0.970899 -208 CACATACTGCATGCCTGCAGTGCATCCCCA 3 119 0 ATGCCTGCAG 0.951818 -182 ATAAGCGAAGAGTTCTAGAGAAATGTAGGA 3 186 1 AGTTCTAGAG 0.766963 -115 TTTGTTTGGCAGTCCTACATTTCTCTAGAA 3 198 0 AGTCCTACAT 0.937106 -103 GGCGATTCTCCTGCCTATAGGGAGTTGGCC 3 277 1 CTGCCTATAG 0.937879 -24 ********** Masking position 6 Map Score: 11.1382 Number of sites scoring better than the average of aligned sites = 332 Number in coding regions = 294 Number in noncoding regions = 38 Number of orfs with sites within 600 bp upstream = 42 Fraction of orfs with sites within 600 bp upstream = 0.0067459 Motif number 2 AAGACGGGAGGGGTTTTTCTAGGCCTAAAT 2 23 1 GGGTTTTTCT 0.99022 -132 CTGATCAACAGGCTTTTTTTTATCTAAAAA 2 53 1 GGCTTTTTTT 0.941582 -102 CCTAGATTTCTTGTTTTTCTTAAGATAAAC 2 85 1 TTGTTTTTCT 0.975958 -70 GGATTGATCATTGTTTTTTTGAATTTTGGA 3 60 0 TTGTTTTTTT 0.971111 -241 GTATGACAAGGGGTTTTTTGAATAAGCGAA 3 165 1 GGGTTTTTTG 0.982584 -136 AAATACAATAGTGTATTTTTTGTTTGGCAG 3 216 0 GTGTATTTTT 0.967952 -85 AAATACACTATTGTATTTCGCGATACTTTC 3 228 1 TTGTATTTCG 0.922379 -73 ********** Masking position 6 Map Score: 8.89291 Number of sites scoring better than the average of aligned sites = 363 Number in coding regions = 290 Number in noncoding regions = 73 Number of orfs with sites within 600 bp upstream = 79 Fraction of orfs with sites within 600 bp upstream = 0.0126887 Motif number 3 TTATCTAAAAATCCCTAGATTTCTTGTTTT 2 72 1 ATCCCTAGAT 0.888654 -83 ATCATAGTAGATTCTAAAACAGTTGATATT 3 31 1 ATTCTAAAAC 0.763833 -270 AACAGTTGATATTCCAAAATTCAAAAAAAC 3 48 1 ATTCCAAAAT 0.963775 -253 ACAATGATCAATCCCAAAATTCGCGATTTG 3 76 1 ATCCCAAAAT 0.984403 -225 CCCAAACTATATCCCTACAAATCGCGAATT 3 93 0 ATCCCTACAA 0.860301 -208 CCTGCAGTGCATCCCCAAACTATATCCCTA 3 106 0 ATCCCCAAAC 0.989403 -195 CTCTTCGCTTATTCAAAAAACCCCTTGTCA 3 168 0 ATTCAAAAAA 0.672906 -133 GAAATGTAGGACTGCCAAACAAAAAATACA 3 205 1 ACTGCCAAAC 0.786657 -96 TAATGAAAGTATCGCGAAATACAATAGTGT 3 232 0 ATCGCGAAAT 0.925419 -69 AGGCAGGAGAATCGCCAAAACGGGTGGGAG 3 263 0 ATCGCCAAAA 0.963433 -38 ********** Masking position 7 Map Score: 6.99058 Number of sites scoring better than the average of aligned sites = 1934 Number in coding regions = 1696 Number in noncoding regions = 238 Number of orfs with sites within 600 bp upstream = 258 Fraction of orfs with sites within 600 bp upstream = 0.0414391 Motif number 4 GGCCTAGAAAAACCCCTCCCGTCTTTTCTA 2 18 0 AACCCCTCCC 0.970765 -137 AAAAAACAATGATCAATCCCAAAATTCGCG 3 71 1 GATCAATCCC 0.928487 -230 GCATCCCCAAACTATATCCCTACAAATCGC 3 98 0 ACTATATCCC 0.914991 -203 GCATGCCTGCAGTGCATCCCCAAACTATAT 3 111 0 AGTGCATCCC 0.980976 -190 CCCATCACATACTGCATGCCTGCAGTGCAT 3 124 0 ACTGCATGCC 0.925548 -177 TCATACTATTGGTCCTTCCCATCACATACT 3 141 0 GGTCCTTCCC 0.957181 -160 CGATACTTTCATTACCTCCCACCCGTTTTG 3 248 1 ATTACCTCCC 0.95485 -53 AAAAGGCCAACTCCCTATAGGCAGG 3 286 0 GCCAACTCCC 0.927035 -15 ********** Masking position 7 Map Score: 3.01683 Number of sites scoring better than the average of aligned sites = 1550 Number in coding regions = 1382 Number in noncoding regions = 168 Number of orfs with sites within 600 bp upstream = 190 Fraction of orfs with sites within 600 bp upstream = 0.0305172 Motif number 5 ********** No masking Map Score: -4.16788e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -4.16788e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -4.16788e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0