AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i070_synecho_ctra_300.orf -o070_synecho_ctra_300.ace -a/home/amcguire/genomes/ORF_synecho.txt -z/home/amcguire/genomes/synecho.fna -g0.46 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY27502 259 Synechocystis #2 RCY49628 270 Synechocystis #3 RCY42700 127 Synechocystis Motif number 1 TTAATTCCATTACTGCCCAATCATTCATTC 1 87 1 TACTGCCCAA 0.958371 -173 GGCAATAGTGGCTTGACCCAGAGGCGATCG 1 178 0 GCTTGACCCA 0.984144 -82 TTGCCTCTGGCCCAGACCAAGCCCGATAAT 1 203 1 CCCAGACCAA 0.930376 -57 AGTCCGGTAAGCTTGACCCAGGTGTAATCC 2 12 0 GCTTGACCCA 0.984144 -259 GCCCCCAGGCGATCGCCCACAAGTCCGGTA 2 33 0 GATCGCCCAC 0.934738 -238 AAAATTGGCAGAATGCCCCCAGGCGATCGC 2 47 0 GAATGCCCCC 0.972817 -224 CTCCAACCAGGACAGACCAAGCCCTGAACT 2 90 1 GACAGACCAA 0.925005 -181 AGAATTGGATTATTGCCCAAACGATTAATA 2 138 0 TATTGCCCAA 0.947039 -133 AACCTCGGGCCATTGCCCCCCATGATTTCT 2 209 1 CATTGCCCCC 0.985167 -62 CATTCTTTCACCATGACCCCATCCGCCCCA 2 242 1 CCATGACCCC 0.95324 -29 GTATTCTTTTCCCTGCCCAAGTCCAGATAG 3 52 1 CCCTGCCCAA 0.989181 -76 ********** Masking position 7 Map Score: 16.0786 Number of sites scoring better than the average of aligned sites = 2253 Number in coding regions = 2035 Number in noncoding regions = 218 Number of orfs with sites within 600 bp upstream = 238 Fraction of orfs with sites within 600 bp upstream = 0.0382268 Motif number 2 CATTCAGGTAGCCATGGTCTAAGTAAACTA 1 112 1 GCCATGGTCT 0.979503 -148 TATCCGCCAAGCGATCGCCTCTGGGTCAAG 1 167 1 GCGATCGCCT 0.998653 -93 GGACTTGTGGGCGATCGCCTGGGGGCATTC 2 37 1 GCGATCGCCT 0.998653 -234 ATCATGGGGGGCAATGGCCCGAGGTTCCAT 2 205 0 GCAATGGCCC 0.982966 -66 TAGGTTACTGGCGATCGGCTCCCCATTCTA 3 79 0 GCGATCGGCT 0.996397 -49 ********** Masking position 5 Map Score: 8.77578 Number of sites scoring better than the average of aligned sites = 2275 Number in coding regions = 2081 Number in noncoding regions = 194 Number of orfs with sites within 600 bp upstream = 203 Fraction of orfs with sites within 600 bp upstream = 0.0326052 Motif number 3 AGTAAAATATCCATCTATTCATCTGGTTTA 1 53 0 CCATCTATTC 0.914955 -207 TATTTTACTCCCATTAATTCCATTACTGCC 1 74 1 CCATTAATTC 0.983331 -186 CCATTACTGCCCAATCATTCATTCAGGTAG 1 93 1 CCAATCATTC 0.970341 -167 TAATGCCAGAGCATTAATCCCCATTTTCCC 1 229 1 GCATTAATCC 0.915568 -31 GCATTAATCCCCATTTTCCCTGCTATTTGC 1 239 1 CCATTTTCCC 0.884528 -21 GGGCATTCTGCCAATTTTTCTGATTATAGG 2 59 1 CCAATTTTTC 0.95423 -212 AATCGTTTGGGCAATAATCCAATTCTGAAA 2 142 1 GCAATAATCC 0.842848 -129 CCATTGCCCCCCATGATTTCTTGTCATTCT 2 218 1 CCATGATTTC 0.933236 -53 TGATTTCTTGTCATTCTTTCACCATGACCC 2 231 1 TCATTCTTTC 0.889909 -40 GATCGGCTCCCCATTCTATCTGGACTTGGG 3 67 0 CCATTCTATC 0.919446 -61 ********** Masking position 3 Map Score: 7.70791 Number of sites scoring better than the average of aligned sites = 1168 Number in coding regions = 1016 Number in noncoding regions = 152 Number of orfs with sites within 600 bp upstream = 170 Fraction of orfs with sites within 600 bp upstream = 0.0273049 Motif number 4 ATATTTATTTGGGAGTTAAAGCCTAGCCA 1 10 0 GGGAGTTAAA 0.941184 -250 TGGAATTAATGGGAGTAAAATATCCATCTA 1 66 0 GGGAGTAAAA 0.98136 -194 GGCAAATAGCAGGGAAAATGGGGATTAA 1 242 0 GCAGGGAAAA 0.977411 -18 AAGAAATCATGGGGGGCAATGGCCCGAGGT 2 210 0 GGGGGGCAAT 0.964574 -61 CTGGACTTGGGCAGGGAAAAGAATACTGAA 3 48 0 GCAGGGAAAA 0.977411 -80 GAAAGGCAACGGGAGGAAAATT 3 116 1 GGGAGGAAAA 0.993623 -12 ********** Masking position 8 Map Score: 6.05902 Number of sites scoring better than the average of aligned sites = 1291 Number in coding regions = 1105 Number in noncoding regions = 186 Number of orfs with sites within 600 bp upstream = 186 Fraction of orfs with sites within 600 bp upstream = 0.0298747 Motif number 5 ACTATTGCCTCTGGCCCAGACCAAGCCCGA 1 199 1 CTGGCCCAGA 0.962355 -61 TGGCCCAGACCAAGCCCGATAATGCCAGAG 1 210 1 CAAGCCCGAT 0.974761 -50 CGATCGCCCACAAGTCCGGTAAGCTTGACC 2 24 0 CAAGTCCGGT 0.988944 -247 CAGGACAGACCAAGCCCTGAACTATATGTT 2 97 1 CAAGCCCTGA 0.990641 -174 TTTCCCTGCCCAAGTCCAGATAGAATGGGG 3 59 1 CAAGTCCAGA 0.988076 -69 ********** Masking position 6 Map Score: 4.00847 Number of sites scoring better than the average of aligned sites = 311 Number in coding regions = 290 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 6 CCATTAATTCCATTACTGCCCAATCATTCA 1 84 1 CATTACTGCC 0.901488 -176 CTAAGTAAACTATTTTCGCCTTGGCAAAAA 1 130 1 TATTTTCGCC 0.694741 -130 GGATACGATTGATTTTTGCCAAGGCGAAAA 1 142 0 GATTTTTGCC 0.952378 -118 AAAAATCAATCGTATCCGCCAAGCGATCGC 1 155 1 CGTATCCGCC 0.878524 -105 TGGGTCAAGCCACTATTGCCTCTGGCCCAG 1 188 1 CACTATTGCC 0.952123 -72 AGCATTAATCCCCATTTTCCCTGCTATTTG 1 238 1 CCCATTTTCC 0.623744 -22 CATTTTCCCTGCTATTTGCC 1 250 1 GCTATTTGCC 0.955981 -10 CGGACTTGTGGGCGATCGCCTGGGGGCATT 2 36 1 GGCGATCGCC 0.498192 -235 TCGCCTGGGGGCATTCTGCCAATTTTTCTG 2 51 1 GCATTCTGCC 0.829418 -220 TTCAGAATTGGATTATTGCCCAAACGATTA 2 141 0 GATTATTGCC 0.945103 -130 TGGAACCTCGGGCCATTGCCCCCCATGATT 2 206 1 GGCCATTGCC 0.64269 -65 TCACCATGACCCCATCCGCCCCAAATTCGA 2 249 1 CCCATCCGCC 0.949575 -22 AGAATGGGGAGCCGATCGCCAGTAACCTAA 3 80 1 GCCGATCGCC 0.813706 -48 ********** Masking position 9 Map Score: 11.9261 Number of sites scoring better than the average of aligned sites = 9679 Number in coding regions = 8785 Number in noncoding regions = 894 Number of orfs with sites within 600 bp upstream = 612 Fraction of orfs with sites within 600 bp upstream = 0.0982975 Motif number 7 ********** No masking Map Score: 1.80721e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 1.80721e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 1.80721e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0