AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i174_synecho_ctra_100.orf -o174_synecho_ctra_100.ace -a/home/amcguire/genomes/ORF_synecho.txt -z/home/amcguire/genomes/synecho.fna -g0.46 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY14039 107 Synechocystis #2 RCY51943 111 Synechocystis #3 RCT00118 300 Chlamydia_trachomatis Motif number 1 TCGTATTTTGTTGTATTGGGGGGTGGGTAAT 1 85 1 TGTATTGGGG 0.99375 -23 TGGGAATGGGGACGCGGGGTC 2 1 1 TGGAATGGGG 0.986231 -111 GTAGAACATGTTGCATTGGCGATACGAAAGC 3 43 1 TGCATTGGCG 0.990209 -258 AAAGCACTGATTGCTATGGAGGGATTCAAGA 3 69 1 TGCTATGGAG 0.973544 -232 CAGTGCAGAATCGCTTTGGGGTGTGCCTGTC 3 115 1 TGCTTTGGGG 0.997201 -186 CAATGGCAATTATTTTTGGGGAACTAAGAGT 3 184 0 TTTTTTGGGG 0.960948 -117 * ********* Masking position 7 Map Score: 8.06845 Number of sites scoring better than the average of aligned sites = 608 Number in coding regions = 557 Number in noncoding regions = 51 Number of orfs with sites within 600 bp upstream = 54 Fraction of orfs with sites within 600 bp upstream = 0.00867331 Motif number 2 GAATTACCCACCCCCCAATACAAC 1 94 0 TACCCACCCC 0.993989 -14 ATCGCCGATATACTGACCCCGCGTCCCCAT 2 16 0 TACTGACCCC 0.953599 -96 TGGCCCACCCAGCTCTAGCGT 2 101 0 GGCCCACCCA 0.945723 -11 CAACATGTTCTACTCTGTCCTATATGCAGA 3 26 0 TACTCTGTCC 0.904308 -275 AAAGCGATTCTGCACTGCGCAGACAAGAAT 3 102 0 TGCACTGCGC 0.920153 -199 TTTCACGACAGGCACACCCCAAAGCGATTC 3 122 0 GGCACACCCC 0.992029 -179 ATTGCCATTGTACACTCTCCTTCTTATCGT 3 205 1 TACACTCTCC 0.96978 -96 ********** Masking position 3 Map Score: 4.07967 Number of sites scoring better than the average of aligned sites = 1444 Number in coding regions = 1307 Number in noncoding regions = 137 Number of orfs with sites within 600 bp upstream = 142 Fraction of orfs with sites within 600 bp upstream = 0.0228076 Motif number 3 CTTGATCAATTGGGTAGATGGATTTTAACC 1 22 1 TGGGTAGATG 0.835665 -86 TGGGAATGGGGACGCGGGGT 2 1 1 TGGGAATGGG 0.840724 -111 ACGCGGGGTCAGTATATCGGCGATCGCCTA 2 22 1 AGTATATCGG 0.818908 -90 GTCTTTTAGTAGAATATCGGGTTTTGTTGA 2 53 0 AGAATATCGG 0.919529 -59 GATCAATTTCTGCATATAGGACAGAGTAGA 3 18 1 TGCATATAGG 0.919529 -283 ATGTATGTAAAGAGAAAAGGAGGATAGAGG 3 151 1 AGAGAAAAGG 0.863411 -150 AGAGAAAAGGAGGATAGAGGGAAACTCTTA 3 161 1 AGGATAGAGG 0.980518 -140 TCTCCTTCTTATCGTAGAGGGTTAAAATTT 3 220 1 ATCGTAGAGG 0.869369 -81 GAAGGAAATGAGAGAAGAGGCC 3 289 1 AGAGAAGAGG 0.970578 -12 ********** Masking position 6 Map Score: 3.40705 Number of sites scoring better than the average of aligned sites = 1436 Number in coding regions = 1276 Number in noncoding regions = 160 Number of orfs with sites within 600 bp upstream = 183 Fraction of orfs with sites within 600 bp upstream = 0.0293929 Motif number 4 CCACCCCCCAATACAACAAAATACGATTAG 1 81 0 ATACAACAAA 0.973016 -27 GCGATCGCCTAGTCAACAAAACCCGATATT 2 41 1 AGTCAACAAA 0.982381 -71 CTATGGAGGGATTCAAGAAAATTCTTGTCT 3 82 1 ATTCAAGAAA 0.967917 -219 TGCACTGCGCAGACAAGAATTTTCTTGAAT 3 92 0 AGACAAGAAT 0.956323 -209 ********** Masking position 5 Map Score: 1.43336 Number of sites scoring better than the average of aligned sites = 47 Number in coding regions = 39 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 5 ATGAGCCTACGGGTTAAAATCCATCTACCC 1 33 0 GGGTTAAAAT 0.991294 -75 TGGGGACGCGGGGTCAGTATATCGGCGATC 2 17 1 GGGTCAGTAT 0.978617 -95 TTATCGTAGAGGGTTAAAATTTTTGACCAC 3 228 1 GGGTTAAAAT 0.991294 -73 ********** Masking position 6 Map Score: 0.816793 Number of sites scoring better than the average of aligned sites = 74 Number in coding regions = 58 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 6 GATTAGTAAAGCTTGAGCTGACCAATGAGC 1 57 0 GCTTGAGCTG 0.997335 -51 GTTTTCCAACGCTAGAGCTGGGTGGGCCA 2 93 1 GCTAGAGCTG 0.997335 -19 ********** Masking position 6 Map Score: 0.225051 Number of sites scoring better than the average of aligned sites = 13 Number in coding regions = 9 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 7 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0