AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i188_synecho_ctra_300.orf -o188_synecho_ctra_300.ace -a/home/amcguire/genomes/ORF_synecho.txt -z/home/amcguire/genomes/synecho.fna -g0.46 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY04876 200 Synechocystis #2 RCY05831 277 Synechocystis #3 RCY37144 238 Synechocystis Motif number 1 CCCAAACTTTGGCGATCGCCTTACTATGCAGATCA 1 41 0 GGCTCCCTAT 0.83229 -160 CCAAAGTTTGGGGCCAATCCTTTGCATTGCTTTAT 1 64 1 GGGAACCTTC 0.994105 -137 AATAGGAATTGGGTCAAACCTTTACGCTGTCCCCG 1 143 1 GGGAACCTTC 0.994105 -58 AGGTTCCCTCCTGAGCAGTCCTTACC 1 185 0 GGTCCCCTAC 0.9029 -16 TGTAGTTTAGTGGTAAAACCTTAGCCTTCCAAGCT 2 81 1 TGGAACCTAC 0.95218 -197 TGATAGGGGTTCGATTCCCCTCACCCGCTTTGGGT 2 118 1 TCGTCCCTAC 0.90529 -160 TATCGAGTTTCGGAGACCGCTGTACCCATTACCCA 2 148 0 CGGACGCTTC 0.940803 -130 GATGTCCGTTGCGACACCCCTCCTCGACCGTCATC 2 212 1 GCGACCCTCC 0.982146 -66 ATTTGTTCGAGGGGTAATGCTGTGCCGACTGTCCA 3 120 1 GGGAAGCTTC 0.975719 -119 CAATGACCTAGGCGATCGCCTGTGCAAAACCTGCC 3 182 1 GGCTCCCTTC 0.989271 -57 TGCAAAACCTGCCGGACTCCTCTGCTGAAAAGGTA 3 204 1 GCCACCCTTC 0.98755 -35 *** ** *** * * Masking position 11 Map Score: 10.7456 Number of sites scoring better than the average of aligned sites = 1326 Number in coding regions = 1234 Number in noncoding regions = 92 Number of orfs with sites within 600 bp upstream = 100 Fraction of orfs with sites within 600 bp upstream = 0.0160617 Motif number 2 CCCCAAACTTTGGCGATCGCCTTACTATGC 1 47 0 TGGCGATCGC 0.990977 -154 AAATTAGCCTTAACGGTCGGTTATTGATGG 1 113 1 TAACGGTCGG 0.891269 -88 AAGCGGGTGAGGGGAATCGAACCCCTATCA 2 118 0 GGGGAATCGA 0.875127 -160 CGGACATCAGGGACGATCAGAAATTATCAA 2 190 0 GGACGATCAG 0.909901 -88 CGGTCGAGGAGGGGTGTCGCAACGGACATC 2 212 0 GGGGTGTCGC 0.91355 -66 GGAGCATGGATGACGGTCGAGGAGGGGTGT 2 225 0 TGACGGTCGA 0.97376 -53 TTGGAGCAGTGGACAGTCGGCACAGCATTA 3 134 0 GGACAGTCGG 0.981075 -105 ATTGGGGGCTTGACAATCGCAGTTGGAGCA 3 156 0 TGACAATCGC 0.970883 -83 GGTTTTGCACAGGCGATCGCCTAGGTCATT 3 183 0 AGGCGATCGC 0.970914 -56 ********** Masking position 7 Map Score: 8.52505 Number of sites scoring better than the average of aligned sites = 8223 Number in coding regions = 7531 Number in noncoding regions = 692 Number of orfs with sites within 600 bp upstream = 468 Fraction of orfs with sites within 600 bp upstream = 0.0751686 Motif number 3 CCAAAGTTTGGGGCCAATCCTTTGCATTGC 1 64 1 GGGCCAATCC 0.983485 -137 AATAGGAATTGGGTCAAACCTTTACGCTGT 1 143 1 GGGTCAAACC 0.986201 -58 TGTAGTTTAGTGGTAAAACCTTAGCCTTCC 2 81 1 TGGTAAAACC 0.964599 -197 CAGATAACCGTGCAGAACCGAGGAATTAT 2 259 0 GTGCAGAACC 0.9672 -19 CCAACTGCGATTGTCAAGCCCCCAATGACC 3 160 1 TTGTCAAGCC 0.924722 -79 GCGATCGCCTGTGCAAAACCTGCCGGACTC 3 193 1 GTGCAAAACC 0.98776 -46 ********** Masking position 7 Map Score: 5.70604 Number of sites scoring better than the average of aligned sites = 606 Number in coding regions = 543 Number in noncoding regions = 63 Number of orfs with sites within 600 bp upstream = 79 Fraction of orfs with sites within 600 bp upstream = 0.0126887 Motif number 4 TGACCCAATTCCTATTCCATCAATAACCGAC 1 128 0 CCTATCCATC 0.886595 -73 CCTGAGCAGTCCTTACCCATCTTACGGGGAC 1 171 0 CCTTCCCATC 0.986664 -30 CCGCTGTACCCATTACCCAAAGCGGGTGAGG 2 136 0 CATTCCCAAA 0.934795 -142 GACGATCAGAAATTATCAATCAAAATTATCG 2 178 0 AATTTCAATC 0.746594 -100 GACCGTCATCCATGCTCCCTCGATAATTCCT 2 237 1 CATGTCCCTC 0.955205 -41 TTGTTTGCAAAATTGCCCCACGAGGATT 3 8 0 AATTCCCCAC 0.951648 -231 ATCTTAAGAACATTTCCAAAAAGTTGTAATA 3 62 0 CATTCCAAAA 0.738426 -177 GTCGGCACAGCATTACCCCTCGAACAAATTT 3 118 0 CATTCCCCTC 0.986664 -121 CCGACTGTCCACTGCTCCAACTGCGATTGTC 3 144 1 ACTGTCCAAC 0.850135 -95 **** ****** Masking position 3 Map Score: 4.17729 Number of sites scoring better than the average of aligned sites = 2545 Number in coding regions = 2268 Number in noncoding regions = 277 Number of orfs with sites within 600 bp upstream = 289 Fraction of orfs with sites within 600 bp upstream = 0.0464182 Motif number 5 AGGTCTTGATCTGCATAGTAAGGCGATCGC 1 35 1 CTGCATAGTA 0.870283 -166 GTAAGGCGATCGCCAAAGTTTGGGGCCAAT 1 52 1 CGCCAAAGTT 0.977703 -149 CGGGAAAGTTCTCCTGACAA 2 1 1 CGGGAAAGTT 0.958192 -277 GTCTCCGAAACTCGATAATTTTGATTGATA 2 166 1 CTCGATAATT 0.946182 -112 TCCATGCTCCCTCGATAATTCCTCGGTTCT 2 245 1 CTCGATAATT 0.946182 -33 GAGAAAAAACCGCCATTGTTTGCAAAATTG 3 24 0 CGCCATTGTT 0.952793 -215 ********** Masking position 5 Map Score: 1.92135 Number of sites scoring better than the average of aligned sites = 378 Number in coding regions = 343 Number in noncoding regions = 35 Number of orfs with sites within 600 bp upstream = 46 Fraction of orfs with sites within 600 bp upstream = 0.00738837 Motif number 6 ********** No masking Map Score: -4.67335e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -4.67335e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -4.67335e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0