AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i205_synecho_ctra_100.orf -o205_synecho_ctra_100.ace -a/home/amcguire/genomes/ORF_synecho.txt -z/home/amcguire/genomes/synecho.fna -g0.46 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY38416 130 Synechocystis #2 RCT00758 300 Chlamydia_trachomatis Motif number 1 TTACTAAAAATTTACTATATTTT 1 2 1 TAAAAAATTT 0.96722 -129 CGGCAATCCATAGGAAAAAATATAGTAAATTT 1 18 0 TAAAAAAATA 0.767234 -113 TAAAGGCTGCTCCACAGAATTTTCCCTTTCC 1 110 1 TCCAGAATTT 0.976689 -21 GCATCGCGTGTAAAAAAAATATTGTACGATGC 2 39 0 TAAAAAATAT 0.915268 -262 AAGCACACATTCCCAAGAAAATTATAGTGCGT 2 104 0 TCAAGAAAAT 0.944086 -197 TTCCTTTTTCTCTTAAGAATTTTGCTTCCCAA 2 152 1 TCAAGAATTT 0.986665 -149 AGTCTTGTATTCCCCAAAAATTCAACACCGTT 2 184 1 TCCAAAAATT 0.963828 -117 TATTGCGTGATCGAAAAAATTTTTTATTCGTA 2 267 0 TCAAAAATTT 0.986926 -34 ** ******** Masking position 6 Map Score: 7.81983 Number of sites scoring better than the average of aligned sites = 434 Number in coding regions = 325 Number in noncoding regions = 109 Number of orfs with sites within 600 bp upstream = 130 Fraction of orfs with sites within 600 bp upstream = 0.0208802 Motif number 2 TTGCCGACTTAAGTGCACTAATCAATGCAC 1 44 1 AAGTGCACTA 0.562956 -87 ATCATCAAACTAGTGCATTGATTAGTGCAC 1 56 0 TAGTGCATTG 0.819513 -75 AGCAGCCTTTAATTGTATGAGATTTATCGA 1 91 0 AATTGTATGA 0.909088 -40 GTAAAAAAAATATTGTACGATGCTTATATT 2 32 0 TATTGTACGA 0.93373 -269 AAGAAAATTATAGTGCGTTACCATGGCGGA 2 92 0 TAGTGCGTTA 0.875459 -209 CTTTATCTAGTATTGCGTGATCGAAAAAAT 2 279 0 TATTGCGTGA 0.978068 -22 ********** Masking position 4 Map Score: 2.14024 Number of sites scoring better than the average of aligned sites = 135 Number in coding regions = 121 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 3 ACTTAAGTCGGCAATCCATAGGAAAAAATA 1 28 0 GCAATCCATA 0.969549 -103 GAGATTTATCGAAAGCCATCATCAAACTAG 1 73 0 GAAAGCCATC 0.980773 -58 AAGAGAAAAAGGAATCCATCAGGGAGAAAG 2 136 0 GGAATCCATC 0.992119 -165 TTATGTATCAGAAAACCTTCGAAACGCGAG 2 221 0 GAAAACCTTC 0.964163 -80 ********** Masking position 4 Map Score: 2.04723 Number of sites scoring better than the average of aligned sites = 165 Number in coding regions = 152 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 4 ATGGCGGATCCTTTATCGCCGAAGAGCGGGCA 2 68 0 CTTTTCCCGA 0.994904 -233 ATGTGTGCTTCTTTCTCCCTGATGGATTCCTT 2 126 1 CTTTTCCTGA 0.992139 -175 TGATGGATTCCTTTTTCTCTTAAGAATTTTGC 2 145 1 CTTTTCCTTA 0.991519 -156 TACATAAGAGCCTGTTCCCCTACTACGAATAA 2 244 1 CCTGTCCCTA 0.973475 -57 AGCTTTATCTAGTATTGCGTGATC 2 287 0 CTTTTCAGTA 0.949573 -14 **** ** **** Masking position 6 Map Score: 2.03944 Number of sites scoring better than the average of aligned sites = 80 Number in coding regions = 71 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 5 TGTACGATGCTTATATTCACGAATAGTGGAT 2 18 0 TTATATTCCG 0.972795 -283 ACAATATTTTTTTTACACGCGATGCCCGCTC 2 46 1 TTTTACACCG 0.982242 -255 TCCCAAAGTCTTGTATTCCCCAAAAATTCAA 2 178 1 TTGTATTCCC 0.97325 -123 TTCAACACCGTTGTACACTCGCGTTTCGAAG 2 204 1 TTGTACACCG 0.993415 -97 ******** ** Masking position 5 Map Score: 0.24852 Number of sites scoring better than the average of aligned sites = 17 Number in coding regions = 14 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 6 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0