AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i205_synecho_ctra_300.orf -o205_synecho_ctra_300.ace -a/home/amcguire/genomes/ORF_synecho.txt -z/home/amcguire/genomes/synecho.fna -g0.46 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY38416 130 Synechocystis #2 RCT00758 300 Chlamydia_trachomatis Motif number 1 TTACTAAAAATTTACTATATTTT 1 2 1 TAAAAAATTT 0.960527 -129 CGGCAATCCATAGGAAAAAATATAGTAAATTT 1 18 0 TAAAAAAATA 0.731058 -113 TAAAGGCTGCTCCACAGAATTTTCCCTTTCC 1 110 1 TCCAGAATTT 0.971873 -21 GCATCGCGTGTAAAAAAAATATTGTACGATGC 2 39 0 TAAAAAATAT 0.899073 -262 AAGCACACATTCCCAAGAAAATTATAGTGCGT 2 104 0 TCAAGAAAAT 0.932995 -197 TTCCTTTTTCTCTTAAGAATTTTGCTTCCCAA 2 152 1 TCAAGAATTT 0.983876 -149 AGTCTTGTATTCCCCAAAAATTCAACACCGTT 2 184 1 TCCAAAAATT 0.956473 -117 TATTGCGTGATCGAAAAAATTTTTTATTCGTA 2 267 0 TCAAAAATTT 0.98419 -34 ** ******** Masking position 6 Map Score: 7.81983 Number of sites scoring better than the average of aligned sites = 434 Number in coding regions = 325 Number in noncoding regions = 109 Number of orfs with sites within 600 bp upstream = 130 Fraction of orfs with sites within 600 bp upstream = 0.0208802 Motif number 2 TTGCCGACTTAAGTGCACTAATCAATGCAC 1 44 1 AAGTGCACTA 0.573309 -87 ATCATCAAACTAGTGCATTGATTAGTGCAC 1 56 0 TAGTGCATTG 0.82975 -75 AGCAGCCTTTAATTGTATGAGATTTATCGA 1 91 0 AATTGTATGA 0.889715 -40 GTAAAAAAAATATTGTACGATGCTTATATT 2 32 0 TATTGTACGA 0.921391 -269 AAGAAAATTATAGTGCGTTACCATGGCGGA 2 92 0 TAGTGCGTTA 0.88732 -209 CTTTATCTAGTATTGCGTGATCGAAAAAAT 2 279 0 TATTGCGTGA 0.973192 -22 ********** Masking position 4 Map Score: 2.14024 Number of sites scoring better than the average of aligned sites = 135 Number in coding regions = 121 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 3 TATTTTTTCCTATGGATTGCCGACTTAAGT 1 28 1 TATGGATTGC 0.975289 -103 CTAGTTTGATGATGGCTTTCGATAAATCTC 1 73 1 GATGGCTTTC 0.979607 -58 CTTTCTCCCTGATGGATTCCTTTTTCTCTT 2 136 1 GATGGATTCC 0.993616 -165 CTCGCGTTTCGAAGGTTTTCTGATACATAA 2 221 1 GAAGGTTTTC 0.967875 -80 ********** Masking position 7 Map Score: 2.04723 Number of sites scoring better than the average of aligned sites = 165 Number in coding regions = 152 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 4 TGCCCGCTCTTCGGCGATAAAGGATCCGCCAT 2 68 1 TCGCGAAAAG 0.990842 -233 AAGGAATCCATCAGGGAGAAAGAAGCACACAT 2 126 0 TCGGGAAAAG 0.995003 -175 GCAAAATTCTTAAGAGAAAAAGGAATCCATCA 2 145 0 TAGAGAAAAG 0.991684 -156 TTATTCGTAGTAGGGGAACAGGCTCTTATGTA 2 244 0 TAGGGACAGG 0.97398 -57 GATCACGCAATACTAGATAAAGCT 2 287 1 TATAGAAAAG 0.958072 -14 ** **** **** Masking position 7 Map Score: 2.03944 Number of sites scoring better than the average of aligned sites = 79 Number in coding regions = 66 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 5 TGTACGATGCTTATATTCACGAATAGTGGAT 2 18 0 TTATATTCCG 0.975337 -283 ACAATATTTTTTTTACACGCGATGCCCGCTC 2 46 1 TTTTACACCG 0.983915 -255 TCCCAAAGTCTTGTATTCCCCAAAAATTCAA 2 178 1 TTGTATTCCC 0.97575 -123 TTCAACACCGTTGTACACTCGCGTTTCGAAG 2 204 1 TTGTACACCG 0.994042 -97 ******** ** Masking position 5 Map Score: 0.24852 Number of sites scoring better than the average of aligned sites = 17 Number in coding regions = 14 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 6 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0