AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i211_synecho_ctra_100.orf -o211_synecho_ctra_100.ace -a/home/amcguire/genomes/ORF_synecho.txt -z/home/amcguire/genomes/synecho.fna -g0.46 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY30174 31 Synechocystis #2 RCY42399 64 Synechocystis #3 RCY23794 104 Synechocystis #4 RCT00022 75 Chlamydia_trachomatis #5 RCT00470 138 Chlamydia_trachomatis Motif number 1 GGGTACGGGTAAATCCAAATCTCCAA 1 7 0 AAATCCAAAT 0.945023 -25 CCAAGCCAAATTAGCAAGGCA 2 2 1 CAAGCCAAAT 0.995077 -63 GCCAAATTAGCAAGGCAAATAATTATGTCC 2 15 1 CAAGGCAAAT 0.978876 -50 CAAGCTCAATGGGTTTGATT 3 1 1 CAAGCTCAAT 0.971227 -104 TTGACAACCCCAAAATCACTATCT 4 62 0 CAACCCCAAA 0.973652 -14 GCAAACCCTAATAAATCTATTA 5 127 0 AAACCCTAAT 0.948866 -12 ********** Masking position 3 Map Score: 5.69398 Number of sites scoring better than the average of aligned sites = 713 Number in coding regions = 641 Number in noncoding regions = 72 Number of orfs with sites within 600 bp upstream = 76 Fraction of orfs with sites within 600 bp upstream = 0.0122069 Motif number 2 TTTTCAAAAATACCCCCGCTTAATAACGGG 2 43 0 TACCCCCGCT 0.990071 -22 TGGGTTTGATTACTGCTGCTTGCCTTAGAG 3 20 1 TACTGCTGCT 0.953437 -85 CCTTAGAGTAACCCCCTGTTGTTAATTTTT 3 42 1 ACCCCCTGTT 0.960483 -63 TCGGGTATGCTCTCCCTTCTGTTATGTGAG 4 18 1 TCTCCCTTCT 0.904387 -58 TGGAATACTATACTCCAGGTCCTTTTCTTC 5 17 0 TACTCCAGGT 0.973931 -122 TGGAGTATAGTATTCCAGGTCTTTTAATTT 5 30 1 TATTCCAGGT 0.914914 -109 CTTTTTATAATCCCCCTGTTTTAGTACCGT 5 73 1 TCCCCCTGTT 0.99162 -66 ********** Masking position 10 Map Score: 5.31242 Number of sites scoring better than the average of aligned sites = 2263 Number in coding regions = 2083 Number in noncoding regions = 180 Number of orfs with sites within 600 bp upstream = 197 Fraction of orfs with sites within 600 bp upstream = 0.0316415 Motif number 3 AGTTTTCAAAAATACCCCCGCTTAATAACG 2 45 0 AAATACCCCG 0.996503 -20 CTTGCCTTAGAGTAACCCCCTGTTGTTAATTT 3 38 1 ATAACCCCCG 0.9943 -67 GACCTGGAATACTATACTCCAGGTCCTTTTCT 5 19 0 ATATACTCCG 0.986248 -120 AATTCTTTTTATAATCCCCCTGTTTTAGTACC 5 69 1 AAATCCCCCG 0.997736 -70 * ******** * Masking position 4 Map Score: 3.38491 Number of sites scoring better than the average of aligned sites = 180 Number in coding regions = 158 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 4 AGATTTGGATTTACCCGTACCCCTCTA 1 15 1 TTACCCGTAC 0.921083 -17 CCCCCGCTTAATAACGGGACATAATTATTT 2 31 0 ATAACGGGAC 0.982474 -34 GTGTCGCATGGTAACTGAACTCCTAAAAAA 3 67 0 GTAACTGAAC 0.944045 -38 AAGGGAGAGCATACCCGAACATTTT 4 6 0 ATACCCGAAC 0.987107 -70 AAAATCTCACATAACAGAAGGGAGAGCATA 4 23 0 ATAACAGAAG 0.897794 -53 CATTAGCAACAAAACGGTACTAAAACAGGG 5 86 0 AAAACGGTAC 0.945928 -53 ********** Masking position 3 Map Score: 2.01192 Number of sites scoring better than the average of aligned sites = 198 Number in coding regions = 179 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 5 ATAACGGGACATAATTATTTGCCTTGCTAA 2 21 0 ATAATTATTT 0.928187 -44 CCCCCTGTTGTTAATTTTTTAGGAGTTCAG 3 53 1 TTAATTTTTT 0.927825 -52 TCCAGGTCTTTTAATTTTTATTTAAAAATT 5 43 1 TTAATTTTTA 0.948515 -96 GATTATAAAAAGAATTTTTAAATAAAAATT 5 55 0 AGAATTTTTA 0.966085 -84 AGCGATTAATAGATTTATTAGGGTTTGC 5 121 1 AGATTTATTA 0.858824 -18 ********** Masking position 5 Map Score: 1.37927 Number of sites scoring better than the average of aligned sites = 311 Number in coding regions = 243 Number in noncoding regions = 68 Number of orfs with sites within 600 bp upstream = 89 Fraction of orfs with sites within 600 bp upstream = 0.0142949 Motif number 6 ********** No masking Map Score: 8.19556e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 8.19556e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 8.19556e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0