AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i299_synecho_ctra_100.orf -o299_synecho_ctra_100.ace -a/home/amcguire/genomes/ORF_synecho.txt -z/home/amcguire/genomes/synecho.fna -g0.46 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY35846 218 Synechocystis #2 RCY33500 23 Synechocystis #3 RCT00579 80 Chlamydia_trachomatis #4 RCT00626 300 Chlamydia_trachomatis Motif number 1 AAGAAAGCAGGGGAAGATTGTCAACCCAATA 1 102 0 GGGAAGATGT 0.994272 -117 GGCAAGCTTAGGGAAGAAAGCAGGGGAAGAT 1 115 0 GGGAAGAAGC 0.990988 -104 AAATGGGAGGGGGAAAAACGTTGAGGGAATA 1 176 0 GGGAAAAAGT 0.963303 -43 CAACCCCAGTGACGAGATAGCAAATGGGAGG 1 197 0 GACGAGATGC 0.897267 -22 GCCTTAGATTAAGGAGAGTGT 3 1 0 AAGGAGAGGT 0.951925 -80 GAATAGAAGAAGGAAGAGTGCTTCCAGAAAA 4 59 0 AGGAAGAGGC 0.974939 -242 GTTTTTTAAAGAGGAAATAGTGAATCCAAGG 4 144 0 GAGGAAATGT 0.934854 -157 ATAAAATCCTAGGAAGAAGGTTTTTTAAAGA 4 163 0 AGGAAGAAGT 0.977624 -138 TCTGTCAGCTGAGAAGATCGTTAAGAACTCT 4 239 1 GAGAAGATGT 0.988807 -62 ******** ** Masking position 5 Map Score: 12.3351 Number of sites scoring better than the average of aligned sites = 591 Number in coding regions = 518 Number in noncoding regions = 73 Number of orfs with sites within 600 bp upstream = 93 Fraction of orfs with sites within 600 bp upstream = 0.0149374 Motif number 2 AATCCATCCTCCACCCCTGGGTTTTGGACGT 1 22 0 CCACCCTGGG 0.984364 -197 TGCATATACTCTATGCCTTAGATTAAGGAGA 3 15 0 CTATCCTTAG 0.973435 -66 CTGGAAGATACTATACCTTAGACTTCGATTT 4 31 1 CTATCCTTAG 0.991555 -270 CTTCCTTCTTCTATTCCTTGAGATGCTTGTT 4 74 1 CTATCCTTGA 0.982251 -227 TGCCCATAACCCATTCCTTGGATTCACTATT 4 129 1 CCATCCTTGG 0.995062 -172 **** ****** Masking position 8 Map Score: 6.03774 Number of sites scoring better than the average of aligned sites = 207 Number in coding regions = 194 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 3 TCCACCCCTGGGTTTTGGACGTTCACCGTGGGT 1 7 0 GGTTGGGTAC 0.99624 -212 TGGGGCAATCTGTTTGGGTCGCTAAGGTCAGAAATCC 1 48 0 TGTTGGGTAG 0.994119 -171 TACACTAGCTTTATTGGGTTGACAATCTTCCCCTGCT 1 91 1 TTTTGGGCAC 0.957515 -128 TTAGCGATTATGGTTCGTTTGCTCATGGTATTCCCTC 1 148 1 TGTTGTGTAG 0.982793 -71 TTATGGGCAAGGATTCGGCGGATTAGCAGTTTGAACA 4 101 0 GGTTGGGTAC 0.996284 -200 CATTTGCGTTTGATTGGTACGAGAAACCTTATAAAAT 4 187 0 TGTTGTGGAC 0.98009 -114 ** ** ** * * * * Masking position 5 Map Score: 2.44629 Number of sites scoring better than the average of aligned sites = 151 Number in coding regions = 138 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 4 CCAAAACCCAGGGGTGGAGGATGGATTTCTGA 1 26 1 GGGTGAGGAT 0.983892 -193 ATATATTTTCGGGTTCGAAGAAAATTTTCGAG 3 48 0 GGGTGAAGAA 0.994036 -33 CACTTCCATAGTGCTGGAAGATACTATACCTT 4 18 1 GTGTGAAGAT 0.982574 -283 AGAAGGAAGAGTGCTTCCAGAAAATCGAAGTC 4 51 0 GTGTCCAGAA 0.914747 -250 AGCATCTCAAGGAATAGAAGAAGGAAGAGTGC 4 69 0 GGATGAAGAA 0.982592 -232 AGGATTCGGCGGATTAGCAGTTTGAACAAGCA 4 97 0 GGATGCAGTT 0.920286 -204 *** * ****** Masking position 5 Map Score: 2.20066 Number of sites scoring better than the average of aligned sites = 425 Number in coding regions = 379 Number in noncoding regions = 46 Number of orfs with sites within 600 bp upstream = 53 Fraction of orfs with sites within 600 bp upstream = 0.00851269 Motif number 5 CCAGGGGTGGAGGATGGATTTCTGACCTTAGCGACCCAA 1 33 1 ATGGATCCTT 0.988315 -186 TTTCTTCCCTAAGCTTGCCTGTTAGCGATTATGGTTCGT 1 127 1 ATTGCTCGAT 0.933516 -92 GAGGGGGAAAAACGTTGAGGGAATACCATGAGCAAACGA 1 162 0 ATTGAACCAT 0.985799 -57 ATCTTCCAGCACTATGGAAGTGTTTCCTT 4 1 0 ATGGATCCTT 0.988316 -300 AATCCGCCGAATCCTTGCCCATAACCCATTCCTTGGATT 4 114 1 ATTGCACCAT 0.979182 -187 CAGCTGACAGAAATTTGACTATACACCATTTGCGTTTGA 4 211 0 ATTGAACCAT 0.985278 -90 ATCCTTTTTTAGAGTGGAATTGTGCCTTTAGTCAGAGTT 4 264 0 ATGGATCTTT 0.929005 -37 * **** * **** Masking position 1 Map Score: 1.65213 Number of sites scoring better than the average of aligned sites = 230 Number in coding regions = 198 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 6 AAGCTAGTGTAGCGAATTGGGGCAATCTGTTTGG 1 68 0 AGGTTGGGCA 0.948439 -151 ACGAACCATAATCGCTAACAGGCAAGCTTAGGGA 1 132 0 ATGAAAGGCA 0.980102 -87 AATCTAAGGCATAGAGTATATGCATTCTCGAAAA 3 22 1 ATGTAATGCA 0.96865 -59 AATCCAAGGAATGGGTTATGGGCAAGGATTCGGC 4 119 0 ATGTAGGGCA 0.993997 -182 TCAAACGCAAATGGTGTATAGTCAAATTTCTGTC 4 211 1 ATGTAAGTCA 0.968649 -90 CGTTAAGAACTCTGACTAAAGGCACAATTCCACT 4 257 1 TCGTAAGGCA 0.956889 -44 ** * ** ***** Masking position 14 Map Score: 0.367152 Number of sites scoring better than the average of aligned sites = 213 Number in coding regions = 187 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 7 GTATATGCATTCTCGAAAATTTTCTTCGAA 3 37 1 TCTCGAAAAT 0.980811 -44 TTTTCTTCGAACCCGAAAATATATATTACA 3 56 1 ACCCGAAAAT 0.98751 -25 GAAGAGTGCTTCCAGAAAATCGAAGTCTAA 4 48 0 TCCAGAAAAT 0.980812 -253 ********** Masking position 6 Map Score: 0.240183 Number of sites scoring better than the average of aligned sites = 29 Number in coding regions = 28 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 8 AGCTAGTGTAGCGAATTGGGGCAATCTGTTT 1 70 0 GCAATTGGGG 0.978048 -149 TGGTTCGTTTGCTCATGGTATTCCCTCAACG 1 158 1 GCCATGGTAT 0.950278 -61 TGACGAGATAGCAAATGGGAGGGGGAAAAAC 1 188 0 GCAATGGGAG 0.990401 -31 TTGCTATCTCGTCACTGGGGTTGG 1 205 1 GTACTGGGGT 0.948842 -14 CCAATCAAACGCAAATGGTGTATAGTCAAAT 4 207 1 GCAATGGTGT 0.989624 -94 ** ******** Masking position 6 Map Score: 0.214947 Number of sites scoring better than the average of aligned sites = 661 Number in coding regions = 606 Number in noncoding regions = 55 Number of orfs with sites within 600 bp upstream = 61 Fraction of orfs with sites within 600 bp upstream = 0.00979762 Motif number 9 ********** No masking Map Score: 1.63668e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: 1.63668e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 11 ********** No masking Map Score: 1.63668e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0