AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i310_synecho_ctra_100.orf -o310_synecho_ctra_100.ace -a/home/amcguire/genomes/ORF_synecho.txt -z/home/amcguire/genomes/synecho.fna -g0.46 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY36605 100 Synechocystis Motif number 1 GGTGAGAGAAAGGGCTCAACGAT 1 3 1 TGAAGAAAGG 0.979361 -98 GGGACAGTGTTGATCGTTGAGCCCTTTCTCT 1 15 0 TGACGTTGAG 0.963683 -86 CCTGTTTTAATGGTTGATGGGCGGTTCTGCC 1 44 1 TGGTGATGGG 0.995528 -57 GACAAAAATTTGGCAGAACCGCCCATCAACC 1 55 0 TGGAGAACCG 0.987207 -46 AGAAGAGAAGTGGAAGTTGGCGACAAAAATT 1 76 0 TGGAGTTGGC 0.989014 -25 AGGCAGAAGAGAAGTGGAAGT 1 90 0 AGGAGAAGAG 0.987691 -11 *** ******* Masking position 6 Map Score: 5.44022 Number of sites scoring better than the average of aligned sites = 2075 Number in coding regions = 1869 Number in noncoding regions = 206 Number of orfs with sites within 600 bp upstream = 221 Fraction of orfs with sites within 600 bp upstream = 0.0354963 Motif number 2 ********** No masking Map Score: -1.04149e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 ********** No masking Map Score: -1.04149e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.04149e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0