AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i340_synecho_ctra_300.orf -o340_synecho_ctra_300.ace -a/home/amcguire/genomes/ORF_synecho.txt -z/home/amcguire/genomes/synecho.fna -g0.46 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY10575 182 Synechocystis Motif number 1 TTTTATAATGGCGATCGCCCTTTAATCACC 1 16 0 GCGATCGCCC 0.996542 -167 AGGTGAGTTACCCCTCGCCCCAGGGGAAAT 1 45 1 CCCCTCGCCC 0.998857 -138 CGAGCATAAACCCATTGCCATTTCCCCTGG 1 64 0 CCCATTGCCA 0.992184 -119 ACTAGCTATGGCCGTCACCATGATTAAACC 1 117 0 GCCGTCACCA 0.980814 -66 CCTTAACACCCCCATCGAACATTT 1 169 1 CCCATCGAAC 0.982082 -14 ********** Masking position 5 Map Score: 6.67981 Number of sites scoring better than the average of aligned sites = 1881 Number in coding regions = 1733 Number in noncoding regions = 148 Number of orfs with sites within 600 bp upstream = 185 Fraction of orfs with sites within 600 bp upstream = 0.0297141 Motif number 2 TGGCGATCGCCCTTTAATCACCAAGCC 1 8 0 CCTTTAATCA 0.992032 -175 GGGTAACTCACCTTTTATAATGGCGATCGC 1 28 0 CCTTTTATAA 0.943897 -155 GTTTATGCTCGCTCCAATCAATACTGCTCC 1 83 1 GCTCCAATCA 0.973814 -100 TGCTCCCGTTGGTTTAATCATGGTGACGGC 1 107 1 GGTTTAATCA 0.990298 -76 GTTAAGGATAGGTTTTAGCAGAAATTTGGA 1 146 0 GGTTTTAGCA 0.975212 -37 ********** Masking position 7 Map Score: 4.27382 Number of sites scoring better than the average of aligned sites = 294 Number in coding regions = 254 Number in noncoding regions = 40 Number of orfs with sites within 600 bp upstream = 53 Fraction of orfs with sites within 600 bp upstream = 0.00851269 Motif number 3 TGGCGATCGCCCTTTAATCACCAAGCC 1 8 0 CCTTTAATCA 0.85011 -175 TATAAAAGGTGAGTTACCCCTCGCCCCAGG 1 39 1 GAGTTACCCC 0.951961 -144 AAACCCATTGCCATTTCCCCTGGGGCGAGG 1 57 0 CCATTTCCCC 0.935792 -126 ATTGGAGCGAGCATAAACCCATTGCCATTT 1 71 0 GCATAAACCC 0.98808 -112 CCGTCACCATGATTAAACCAACGGGAGCAG 1 106 0 GATTAAACCA 0.944688 -77 CCAAATTTCTGCTAAAACCTATCCTTAACA 1 147 1 GCTAAAACCT 0.880709 -36 TAAAACCTATCCTTAACACCCCCATCGAAC 1 159 1 CCTTAACACC 0.96349 -24 ********** Masking position 9 Map Score: 2.03389 Number of sites scoring better than the average of aligned sites = 4404 Number in coding regions = 3923 Number in noncoding regions = 481 Number of orfs with sites within 600 bp upstream = 463 Fraction of orfs with sites within 600 bp upstream = 0.0743656 Motif number 4 ********** No masking Map Score: 2.227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0