AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i027_ecoli_bsub_100.orf -o027_ecoli_bsub_100.ace -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.47 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.47 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 fumC 142 fumarase C= fumarate hydratase Class II; isozyme #2 citG 300 fumarate hydratase Motif number 1 TATCAAATGGTAAATAATAAGTGAGCTAAAA 1 67 1 TAAATATAAG 0.883669 -76 TAACGAAAGCAAAACAGAAAGAAAAAATTAA 1 104 1 AAAACAAAAG 0.982638 -39 AAACAGAAAGAAAAAATTAATCAGGTGAGGA 1 115 1 AAAAAATAAT 0.843369 -28 GGCTAGCTGGAAAACAAGAAGAAATTGAACA 2 72 1 AAAACAGAAG 0.962258 -229 GGACAAATCCAAAATACAAATATTCAAAGGA 2 162 1 AAAATAAAAT 0.970635 -139 ATCTTGAATTAAAATTAAAATCTGCCAAGAT 2 204 1 AAAATTAAAT 0.872807 -97 CCAAGATCGAAAAATAAAAAGGATTTTTTGT 2 228 1 AAAATAAAAG 0.985563 -73 ****** **** Masking position 4 Map Score: 5.00081 Number of sites scoring better than the average of aligned sites = 208 Number in coding regions = 135 Number in noncoding regions = 73 Number of orfs with sites within 600 bp upstream = 85 Fraction of orfs with sites within 600 bp upstream = 0.0136524 Motif number 2 ACCATTTGATAACAAATGTTTGGTCTTTCG 1 48 0 AACAAATGTT 0.793927 -95 AACATTTGTTATCAAATGGTAAATAATAAG 1 58 1 ATCAAATGGT 0.92117 -85 CATAATGCTGTTCAAATGATCTAATGAGCT 2 102 0 TTCAAATGAT 0.964831 -199 TCTCTTATACATCAAAGGAGTACGGCAGGA 2 135 1 ATCAAAGGAG 0.953709 -166 AATACAAATATTCAAAGGATTCCCGCGTAT 2 174 1 TTCAAAGGAT 0.988234 -127 GATCGAAAAATAAAAAGGATTTTTTGTGTC 2 232 1 TAAAAAGGAT 0.835748 -69 TAACGGTTGCTTCAATAGATCATAATTCGC 2 266 0 TTCAATAGAT 0.80985 -35 ********** Masking position 5 Map Score: 4.61409 Number of sites scoring better than the average of aligned sites = 275 Number in coding regions = 232 Number in noncoding regions = 43 Number of orfs with sites within 600 bp upstream = 50 Fraction of orfs with sites within 600 bp upstream = 0.00803084 Motif number 3 GTTTTTTTACATGGCACGAAAGACCAAACATTTGTT 1 32 1 AGCAGAAACA 0.990822 -111 AAAAAAACTTACTCCATGAAATACTCTA 2 3 0 ATCAGAAACC 0.996017 -298 TCAAAGGAGTACGGCAGGACAAATCCAAAATACAAA 2 146 1 AGCAGAAATC 0.996017 -155 TTTTAATTTTAATTCAAGATATACGCGGGAATCCTT 2 188 0 ATCAGAAACC 0.996017 -113 TAATTCGCCAATGACACAAAAAATCCTTTTTATTTT 2 238 0 AGCAAAAATC 0.979558 -63 * * ** ** * ** * Masking position 9 Map Score: 2.84055 Number of sites scoring better than the average of aligned sites = 17 Number in coding regions = 17 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 TCTTTCGTGCCATGTAAAAAAACCGCCCCG 1 25 0 CATGTAAAAA 0.940895 -118 GAAAGCAAAACAGAAAGAAAAAATTAATCA 1 108 1 CAGAAAGAAA 0.959341 -35 TAGAGTATTTCATGGAGTAAGTTTTTTTAT 2 11 1 CATGGAGTAA 0.941719 -290 CCTCCGCTTTCATAAAAAAACTTACTCCAT 2 22 0 CATAAAAAAA 0.946956 -279 AGCTGGAAAACAAGAAGAAATTGAACAGCT 2 76 1 CAAGAAGAAA 0.972877 -225 ********** Masking position 6 Map Score: 0.768375 Number of sites scoring better than the average of aligned sites = 253 Number in coding regions = 207 Number in noncoding regions = 46 Number of orfs with sites within 600 bp upstream = 46 Fraction of orfs with sites within 600 bp upstream = 0.00738837 Motif number 5 CGCCCCGAAGGGCGGCTCTGT 1 2 0 GGCGGCTCTG 0.975206 -141 CGCCCTTCGGGGCGGTTTTTTTACATGGCA 1 18 1 GGCGGTTTTT 0.986122 -125 GCTTTCGTTAAGCAACTTTTAGCTCACTTA 1 84 0 AGCAACTTTT 0.879714 -59 TTTCGATCTTGGCAGATTTTAATTTTAATT 2 210 0 GGCAGATTTT 0.982336 -91 TTGTGTCATTGGCGAATTATGATCTATTGA 2 255 1 GGCGAATTAT 0.944144 -46 ********** Masking position 7 Map Score: 0.724425 Number of sites scoring better than the average of aligned sites = 1089 Number in coding regions = 968 Number in noncoding regions = 121 Number of orfs with sites within 600 bp upstream = 101 Fraction of orfs with sites within 600 bp upstream = 0.0162223 Motif number 6 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0