AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i061_ecoli_bsub_100.orf -o061_ecoli_bsub_100.ace -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.47 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.47 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 yffG 205 putative oxidoreductase, Fe-S subunit #2 gltB 300 glutamate synthase, large subunit #3 gltA 146 glutamate synthase (large subunit) Motif number 1 GATTTTTTGTGGAGAAGACGCGT 1 2 0 GGGAAACGCG 0.978913 -204 ATTGCGTTTCAGCGAACTGGAACATTAATGAT 1 31 0 AGGAATGGAA 0.855259 -175 CCGACTTACAGGGGAATCGGCAATGTTCATGT 1 127 0 GGGAACGGCA 0.993189 -79 TTATCTTTAAGGCTAAAAGGGAAGTCGTTAGA 2 49 0 GGTAAAGGGA 0.965823 -252 AGCTGATACAGGTCAAATGGCAAGCTTATTGG 2 139 0 GGCAATGGCA 0.971012 -162 CGGTTAATACGGTGAAGAGGGGATCTCAATTA 2 238 0 GGGAAAGGGG 0.996448 -63 GATGCGAAAAGGACAACAAGGGGGCGAATCGG 2 269 1 GGCAAAAGGG 0.917231 -32 ACAACAAGGGGGCGAATCGGAGGCGCGCGT 2 281 1 GGGAACGGAG 0.991702 -20 GAAATTGATCGGGGGAGAGGAATT 3 133 1 GGGGAAGGAA 0.970035 -14 ** *** ***** Masking position 6 Map Score: 9.22915 Number of sites scoring better than the average of aligned sites = 744 Number in coding regions = 690 Number in noncoding regions = 54 Number of orfs with sites within 600 bp upstream = 57 Fraction of orfs with sites within 600 bp upstream = 0.00915516 Motif number 2 ATCTGCCACAGTTTATAGCGAAATAGTTAC 1 86 1 GTTTATAGCG 0.988469 -120 TTTCGCATCGGTTAATACGGTGAAGAGGGG 2 248 0 GTTAATACGG 0.95716 -53 ATTATATATTGTTTATATCGTTTTGAAAAC 3 58 1 GTTTATATCG 0.969184 -89 AACCTACAATGATTATAGAGTTGTTAGATT 3 85 1 GATTATAGAG 0.937759 -62 ATCAATTTCCGATAATACCGGTCATAAAAT 3 112 0 GATAATACCG 0.976635 -35 ********** Masking position 5 Map Score: 2.569 Number of sites scoring better than the average of aligned sites = 120 Number in coding regions = 105 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 3 CAGGGGAATCGGCAATGTTCATGTGCCCAG 1 121 0 GGCAATGTTC 0.939489 -85 TTATTGGTACAGAAATGTGCTTTAGCGCAA 2 116 0 AGAAATGTGC 0.927836 -185 CAGGTCAAATGGCAAGCTTATTGGTACAGA 2 133 0 GGCAAGCTTA 0.953986 -168 CAACTTATCGGGAAAGCTGATACAGGTCAA 2 155 0 GGAAAGCTGA 0.972572 -146 CCGATAAGTTGGAAATCCGCTGGAAGCTTT 2 174 1 GGAAATCCGC 0.950889 -127 CTGCTCATCCAGAAAGCTTCCAGCGGATTT 2 186 0 AGAAAGCTTC 0.968226 -115 AAATATGATGAGCAGGCTGCTCATCCAGAA 2 202 0 AGCAGGCTGC 0.958992 -99 ********** Masking position 4 Map Score: 4.12858 Number of sites scoring better than the average of aligned sites = 1359 Number in coding regions = 1269 Number in noncoding regions = 90 Number of orfs with sites within 600 bp upstream = 86 Fraction of orfs with sites within 600 bp upstream = 0.013813 Motif number 4 TTAACACACCTTTATGACAGTCAGGAATTG 2 11 1 TTTATGACAG 0.898964 -290 AGAGAAACAGTCAATTCCTGACTGTCATAA 2 22 0 TCAATTCCTG 0.948637 -279 AAAATCCATTTTAATTTCAGTCATTTAATA 2 79 1 TTAATTTCAG 0.93322 -222 AGAGGGGATCTCAATTACTGCATAAATATG 2 225 0 TCAATTACTG 0.969218 -76 GTTGTTAGATTTTATGACCGGTATTATCGG 3 104 1 TTTATGACCG 0.932262 -43 TCTCCCCCGATCAATTTCCGATAATACCGG 3 121 0 TCAATTTCCG 0.97142 -26 ********** Masking position 5 Map Score: 1.63266 Number of sites scoring better than the average of aligned sites = 369 Number in coding regions = 317 Number in noncoding regions = 52 Number of orfs with sites within 600 bp upstream = 63 Fraction of orfs with sites within 600 bp upstream = 0.0101189 Motif number 5 GAATAAGTAACTATTTCGCTATAAACTGTGG 1 91 0 CTTTTCGCTA 0.990573 -115 CAGGAATTGACTGTTTCTCTAACGACTTCCC 2 32 1 CTTTTCTCTA 0.985492 -269 TTAATAAAGAATTTTGCGCTAAAGCACATTT 2 103 1 ATTTGCGCTA 0.976138 -198 TTTTGAGATTCTTTTGATCTAAATTATATAT 3 36 1 CTTTGATCTA 0.963566 -111 ** ******** Masking position 5 Map Score: 0.114963 Number of sites scoring better than the average of aligned sites = 24 Number in coding regions = 16 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 6 ********** No masking Map Score: -1.36181e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.36181e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -1.36181e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0