AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i113_ecoli_bsub_300.orf -o113_ecoli_bsub_300.ace -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.47 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.47 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 yflD 100 yflD #2 yflA 124 similar to aminoacid carrier protein #3 yrbD 300 similar to sodium/proton-dependent alanine carrier protein Motif number 1 TGTTACACTCCTTTTTTCCGATCCAGTT 1 9 1 TCCTTTTTTC 0.990145 -92 TTGGATACGTTCGTTTTTTCTATCGTTTCG 1 43 0 TCGTTTTTTC 0.986399 -58 ATAAAAGCCATCCTTTTTATGTTCCAAGTT 2 38 1 TCCTTTTTAT 0.956858 -87 AAAAACATAAACCTTTTGACATAGAACTTG 2 62 0 ACCTTTTGAC 0.958291 -63 CCCATCACCCTTTTTTCGTTTATGAAT 2 108 0 CCCTTTTTTC 0.959141 -17 GATTGCTTTATCCTTTATATACGGTTTGAC 3 57 1 TCCTTTATAT 0.832478 -244 TCCTTTATATACGGTTTGACTGAACTAGGC 3 67 1 ACGGTTTGAC 0.877017 -234 TCGACTACGCTGCGTTTTTCTACAGAGGCA 3 137 0 TGCGTTTTTC 0.821243 -164 TCGATACGCCGCGTTTTTTCTTTTTCCCTT 3 163 1 GCGTTTTTTC 0.944273 -138 ATTTCTACAATCGATTTGTCACATTATATG 3 218 0 TCGATTTGTC 0.943133 -83 TAGAAATAGTTCGATTAGACCAAAATCCTT 3 241 1 TCGATTAGAC 0.787952 -60 TAGACCAAAATCCTTTTTATACATGTATTC 3 256 1 TCCTTTTTAT 0.956858 -45 ********** Masking position 5 Map Score: 14.4695 Number of sites scoring better than the average of aligned sites = 1186 Number in coding regions = 999 Number in noncoding regions = 187 Number of orfs with sites within 600 bp upstream = 213 Fraction of orfs with sites within 600 bp upstream = 0.0342114 Motif number 2 TTTCGCTCGAACTGGATCGGAAAAAAGGAGTG 1 16 0 ACTGATGGAA 0.947469 -85 AGTTCGAGCGAAACGATAGAAAAAACGAACGT 1 35 1 AAAGATGAAA 0.983059 -66 AACACGAATCAGCAGATTAGAAAAGTGAAAAT 1 76 1 AGCGATAGAA 0.90287 -25 AATCATTTCCCATAGATGGAAAAACATAAACC 2 79 0 CATGATGAAA 0.870211 -46 ATAAGATGAACGGAACAAATGATGA 3 4 1 AGAGAAGGAA 0.976013 -297 TGAACGGAACAAATGATGAAAAGCATTTCAAT 3 17 1 AAAGATAAAA 0.929934 -284 AGCAATCACAAAATGATTGAAATGCTTTTCAT 3 32 0 AAAGATGAAA 0.983059 -269 ATCAATAAGAAGAGGAAGGGAAAAAGAAAAAA 3 176 0 AGAGAAGGAA 0.976013 -125 *** *** **** Masking position 6 Map Score: 5.91292 Number of sites scoring better than the average of aligned sites = 275 Number in coding regions = 235 Number in noncoding regions = 40 Number of orfs with sites within 600 bp upstream = 49 Fraction of orfs with sites within 600 bp upstream = 0.00787022 Motif number 3 AAGGATGGCTTTTATCAATCGCCATCCTGCAGAC 2 19 0 TACAATCCCA 0.991313 -106 TGTCAAAAGGTTTATGTTTTTCCATCTATGGGAA 2 71 1 TAGTTTTCCA 0.900578 -54 TTTTCGTTTATGAATCATTTCCCATAGATGGAAA 2 89 0 TACATTTCCA 0.986615 -36 ATATAAAGGATAAAGCAATCACAAAATGATTGAA 3 43 0 TACAATCCAA 0.95626 -258 TGAAGGATTTTATAACAATTGCCATAAGTTTGCC 3 107 1 TACAATTCCA 0.992768 -194 TTTGGTCTAATCGAACTATTTCTACAATCGATTT 3 231 0 TACTATTCTA 0.928396 -70 * * ***** *** Masking position 9 Map Score: 1.96982 Number of sites scoring better than the average of aligned sites = 180 Number in coding regions = 172 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 4 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0