AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i188_ecoli_bsub_300.orf -o188_ecoli_bsub_300.ace -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.47 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.47 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 menD 88 2-oxoglutarate decarboxylase; SHCHC synthase #2 menF 300 isochorismate hydroxymutase 2, menaquinone biosynthesis #3 menB 34 dihydroxynapthoic acid synthetase #4 menF 288 menaquinone-specific isochorismate synthase Motif number 1 CGGTATCAATATTGCGGCTAAGTATAAGGA 1 60 0 ATTGCGGCTA 0.98719 -29 GCCTCACATTATACGGGGTACTACAAAAAA 2 35 0 ATACGGGGTA 0.930467 -266 GTCGCAAGAGATTCCGGCGACACCCGGCAT 2 130 1 ATTCCGGCGA 0.965662 -171 GATAACCCGAATGCCGGGTGTCGCCGGAAT 2 140 0 ATGCCGGGTG 0.992407 -161 TGCCAGTAGAATTGCGGGTATGTTTGCTGA 2 223 0 ATTGCGGGTA 0.993264 -78 ACTTTCATAAATGGCGGGTGGAGGAATATA 4 68 1 ATGGCGGGTG 0.992477 -221 ********** Masking position 2 Map Score: 6.69844 Number of sites scoring better than the average of aligned sites = 262 Number in coding regions = 242 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 2 CTCCCTACACCGGGGTACTGCATTTTTTTTG 2 11 1 CGGGTACTGC 0.991544 -290 TCACATTATACGGGGTACTACAAAAAAAATG 2 31 0 CGGGTACTAC 0.975394 -270 GAGAGGTCCGCGTGCAATCACTTACTACGGC 2 75 1 CGTGAATCAC 0.921466 -226 AACCCGAATGCCGGGTGTCGCCGGAATCTCT 2 136 0 CCGGTGTCGC 0.972224 -165 ACCCGGCATTCGGGTTATCGATATTCCTTTC 2 151 1 CGGGTATCGA 0.984734 -150 CGACGTAAAACGGGTAATCGCGCCCAGGACG 2 280 0 CGGGAATCGC 0.995441 -21 **** ****** Masking position 4 Map Score: 3.90689 Number of sites scoring better than the average of aligned sites = 717 Number in coding regions = 670 Number in noncoding regions = 47 Number of orfs with sites within 600 bp upstream = 46 Fraction of orfs with sites within 600 bp upstream = 0.00738837 Motif number 3 ACACCGGGGTACTGCATTTTTTTTGTAGTACCCC 2 17 1 ACTGCTTTTT 0.962356 -284 TGGAAAATCTACTGCGCCATTTGTCGCAAGAGAT 2 108 1 ACTGCCTTTT 0.856591 -193 GGTTATCGATATTCCTTTCCCTCTCAAAGACGCT 2 163 1 ATTCCTCCTT 0.811924 -138 ATGATGACCTCCTTTTATTCTCTATGTGAAT 3 14 0 CCTCCTATTT 0.925577 -21 TGTGATCGCCTCGTTTCTCTGTGATGCATACC 4 9 1 CCTCGTTCTT 0.953263 -280 AAAAGGAAAACCTCCTATATTCCTCCACCCGCCA 4 79 0 CCTCCATTCT 0.802394 -210 GTCCAAATGGCCTGCCTTACCTATTATAAACCTA 4 186 0 CCTGCTCCTT 0.991437 -103 GGCCATTTGGACTGCATGATCTGTGTTTGACACA 4 208 1 ACTGCTTCTT 0.983563 -81 ATACCATACACCTGTGTCTCCTTTGTGTCAAACA 4 231 0 CCTGTTCCTT 0.919035 -58 GAGACATTCCTCCATAATCCTTAAAATGCTTT 4 267 0 CCTCCTTCCT 0.983702 -22 ***** * *** * Masking position 3 Map Score: 4.50652 Number of sites scoring better than the average of aligned sites = 818 Number in coding regions = 709 Number in noncoding regions = 109 Number of orfs with sites within 600 bp upstream = 123 Fraction of orfs with sites within 600 bp upstream = 0.0197559 Motif number 4 TCGATATTCCTTTCCCTCTCAAAGACGCTT 2 168 1 TTTCCCTCTC 0.981979 -133 GATGACCTCCTTTTATTCTCTATGTGAATG 3 13 0 TTTTATTCTC 0.894713 -22 TATAGGAGGTTTTCCTTTTATGGTAAGCGG 4 94 1 TTTCCTTTTA 0.911405 -195 CAAGCTTAAATTTCTTTCTCCACTGATAGC 4 135 0 TTTCTTTCTC 0.987374 -154 TTTAAGCTTGTTTCTTTTTCATTTCTGAAA 4 155 1 TTTCTTTTTC 0.971994 -134 ********** Masking position 7 Map Score: 1.52526 Number of sites scoring better than the average of aligned sites = 165 Number in coding regions = 126 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 48 Fraction of orfs with sites within 600 bp upstream = 0.0077096 Motif number 5 TATGAATCGGTAATGATGCGACTCATTA 1 9 0 TAATGATGCG 0.931206 -80 AAAAATAGATTATTGATATGAATCGGTAAT 1 25 0 TATTGATATG 0.887709 -64 TTAGCCGCAATATTGATACCGGACAAACTC 1 69 1 TATTGATACC 0.983632 -20 TCAAAGACGCTTTTGATGCCTTGAGCTGGC 2 186 1 TTTTGATGCC 0.978389 -115 CTTAAAATGCTTTTAATACCATACACCTGT 4 250 0 TTTTAATACC 0.889336 -39 ********** Masking position 6 Map Score: 0.368121 Number of sites scoring better than the average of aligned sites = 359 Number in coding regions = 327 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 35 Fraction of orfs with sites within 600 bp upstream = 0.00562159 Motif number 6 ********** No masking Map Score: 1.40931e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.40931e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 1.40931e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0