AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i239_ecoli_bsub_300.orf -o239_ecoli_bsub_300.ace -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.47 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.47 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 yjdH 180 putative 2-component sensor protein #2 yufL 120 similar to two-component sensor histidine kinase [YufM] Motif number 1 GTGCTGTATGAAGATTCCGGGGCTATGCTT 1 46 0 AAGATTCCGG 0.987345 -135 ACAGCACTGGCAGTTTCCGTTGCCAGAGTC 1 69 1 CAGTTTCCGT 0.959998 -112 CCTTGTGTGACAAATTTCTTAAGCATTATC 1 155 0 CAAATTTCTT 0.876941 -26 CAGCTTCCTTGTGTGACAAA 1 171 0 CAGCTTCCTT 0.989536 -10 CTGCTTTGTGAAGATTTGGGCCCGTAATTC 2 48 0 AAGATTTGGG 0.916072 -73 TCTCAAAATGCTGCTTTGTGAAGATTTGGG 2 58 0 CTGCTTTGTG 0.886542 -63 CTTACGTTTTATGATTCCTGCGTACTACTT 2 91 0 ATGATTCCTG 0.967036 -30 ATAAAACTTCCTTACGTTTTATG 2 108 0 AAACTTCCTT 0.933473 -13 ********** Masking position 5 Map Score: 6.61439 Number of sites scoring better than the average of aligned sites = 2529 Number in coding regions = 2318 Number in noncoding regions = 211 Number of orfs with sites within 600 bp upstream = 221 Fraction of orfs with sites within 600 bp upstream = 0.0354963 Motif number 2 ATACTGATGAGAGAGGGAAGGTC 1 3 0 GAGAGGAAGG 0.993955 -178 AATTCAAAGGGAGTAAGAATGATTGGCTATA 1 109 0 GAGTAAAATG 0.972193 -72 CCCGCCTCATCAGAGATAATGCTTAAGAAAT 1 141 1 CAGAGAAATG 0.986137 -40 TCGTAAAAAGGAGAAAAAATGGAATAATTTA 2 19 0 GAGAAAAATG 0.991394 -102 GCAGCATTTTGAGAGTAAAGTAGTACGCAGG 2 74 1 GAGAGTAAGT 0.95507 -47 ****** **** Masking position 8 Map Score: 2.5638 Number of sites scoring better than the average of aligned sites = 167 Number in coding regions = 138 Number in noncoding regions = 29 Number of orfs with sites within 600 bp upstream = 34 Fraction of orfs with sites within 600 bp upstream = 0.00546097 Motif number 3 GTATGAAGATTCCGGGGCTATGCTTATAGC 1 41 0 TCCGGGGCTA 0.996675 -140 ACTGGCAGTTTCCGTTGCCAGAGTCTCTTC 1 74 1 TCCGTTGCCA 0.991037 -107 TTTTACGAATTACGGGCCCAAATCTTCACA 2 42 1 TACGGGCCCA 0.993561 -79 ********** Masking position 10 Map Score: 0.469867 Number of sites scoring better than the average of aligned sites = 162 Number in coding regions = 151 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 4 ********** No masking Map Score: -4.80737e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -4.80737e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -4.80737e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0