AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i296_ecoli_bsub_100.orf -o296_ecoli_bsub_100.ace -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.47 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.47 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 yqjC 201 similar to hypothetical proteins Motif number 1 GGCGCCTGCTTTTTTATCGTTATAGAAAC 1 8 1 GTTTTTTATG 0.992005 -194 GTGATTTTGGGAGTTTTTATTCTTTCAACTGT 1 58 0 GGTTTTTATC 0.987557 -144 CTGATGAAAAGCGTTTTGATCGTGATTTTGGG 1 79 0 GGTTTTGATG 0.996698 -123 AATATAGACAGATTGTTTAAGGAGAGAAAATC 1 123 0 GTTGTTTAAG 0.974994 -79 ATATTTTAGCGTGTTTTGAATGGGCGGACAAG 1 150 1 GGTTTTGAAG 0.995273 -52 * ******** * Masking position 6 Map Score: 5.75984 Number of sites scoring better than the average of aligned sites = 205 Number in coding regions = 145 Number in noncoding regions = 60 Number of orfs with sites within 600 bp upstream = 65 Fraction of orfs with sites within 600 bp upstream = 0.0104401 Motif number 2 CTCTCAGGAATCGTCATGTTTCTATAACGA 1 27 0 TCGTCATGTT 0.989801 -175 AGCGTTTTGATCGTGATTTTGGGAGTTTTT 1 72 0 TCGTGATTTT 0.993992 -130 AAAACGCTTTTCATCAGTTTTTGAGACATG 1 94 1 TCATCAGTTT 0.984311 -108 AGTTTTTGAGACATGATTTTCTCTCCTTAA 1 109 1 ACATGATTTT 0.976917 -93 ********** Masking position 6 Map Score: 3.49952 Number of sites scoring better than the average of aligned sites = 153 Number in coding regions = 131 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 3 TTGATCGTGATTTTGGGAGTTTTTATTCTT 1 66 0 TTTTGGGAGT 0.96999 -136 ATGAAAAGCGTTTTGATCGTGATTTTGGGA 1 78 0 TTTTGATCGT 0.944417 -124 CTGTCTATATTTTAGCGTGTTTTGAATGGG 1 144 1 TTTAGCGTGT 0.979734 -58 CGCTAATAGATATCGCTTGTCCGCCCATTC 1 167 0 TATCGCTTGT 0.97417 -35 TCATCCCTGCTTTCGCTAATAGATATCGCT 1 180 0 TTTCGCTAAT 0.930767 -22 ********** Masking position 3 Map Score: 0.88804 Number of sites scoring better than the average of aligned sites = 728 Number in coding regions = 664 Number in noncoding regions = 64 Number of orfs with sites within 600 bp upstream = 91 Fraction of orfs with sites within 600 bp upstream = 0.0146161 Motif number 4 TTTTTATCGTTATAGAAACATGACGATTCC 1 21 1 TATAGAAACA 0.973789 -181 TTTCATCAGTTTTTGAGACATGATTTTCTC 1 102 1 TTTTGAGACA 0.957962 -100 ACAGATTGTTTAAGGAGAGAAAATCATGTC 1 118 0 TAAGGAGAGA 0.971318 -84 CACGCTAAAATATAGACAGATTGTTTAAGG 1 133 0 TATAGACAGA 0.982059 -69 ********** Masking position 6 Map Score: 0.0498771 Number of sites scoring better than the average of aligned sites = 62 Number in coding regions = 42 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 5 ********** No masking Map Score: 6.63809e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 6.63809e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 6.63809e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0