AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i076_Lipopolysaccharide_Biosynthesis_1_ecoli_hinf_reg_100.orf -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.46 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 gmd 25 GDP-D-mannose dehydratase #2 wcaA 34 putative regulator #3 BIME92 24 BIME #4 wza 300 putative polysaccharide export protein Motif number 1 TTATATTCGGAAGTTAATTTCCGTAATAAC 4 12 1 AAGTTAATTT 0.862599 -289 TACACTGATTTAGTTTAATTTTTCACACCC 4 71 0 TAGTTTAATT 0.853176 -230 TAAACTAAATCAGTGTATTGGTAGCTAAAA 4 84 1 CAGTGTATTG 0.943228 -217 AGGCTATTGACAGAATAATTCAGACTGGTC 4 148 0 CAGAATAATT 0.82788 -153 ATTTCATCCGCAGGCTATTGACAGAATAAT 4 159 0 CAGGCTATTG 0.943788 -142 GGACTGATGCCAGTTAAATTTTTATTCAAT 4 200 1 CAGTTAAATT 0.961002 -101 ATTTACCTTGCAGTTAATTGAATAAAAATT 4 216 0 CAGTTAATTG 0.924922 -85 AATTAACTGCAAGGTAAATGTGCATGGCGA 4 227 1 AAGGTAAATG 0.911814 -74 TAATAGTGCACAGGATAATTACTCTGCCAA 4 266 1 CAGGATAATT 0.950118 -35 ********** Masking position 7 Map Score: 7.42019 Number of sites scoring better than the average of aligned sites = 1311 Number in coding regions = 1098 Number in noncoding regions = 213 Number of orfs with sites within 600 bp upstream = 210 Fraction of orfs with sites within 600 bp upstream = 0.0337295 Motif number 2 GGGGCGGTGCGAATGCAGGCGTCG 3 5 0 GAATGCAGGC 0.70683 -20 TCTCATCAACGACTGCATGCTGAGAGGGTG 4 46 1 GACTGCATGC 0.892225 -255 GCGGTAGCGTGTCTGGATGCCTGAAAGACC 4 122 1 GTCTGGATGC 0.97667 -179 AATTGATTTCATCCGCAGGCTATTGACAGA 4 164 0 ATCCGCAGGC 0.98074 -137 TTATTCAATTAACTGCAAGGTAAATGTGCA 4 221 1 AACTGCAAGG 0.966552 -80 TGCAAGGTAAATGTGCATGGCGACATTGCT 4 234 1 ATGTGCATGG 0.954076 -67 ********** Masking position 7 Map Score: 4.98282 Number of sites scoring better than the average of aligned sites = 718 Number in coding regions = 668 Number in noncoding regions = 50 Number of orfs with sites within 600 bp upstream = 51 Fraction of orfs with sites within 600 bp upstream = 0.00819146 Motif number 3 AAGCAAACCAGCTCATAAGCCGGGAGAACAA 2 10 1 AGCTCAAGCC 0.992276 -25 GTGTATTGGTAGCTAAAAAGCCAGGGGCGGTA 4 96 1 AGCTAAAGCC 0.973786 -205 CAATTTTTTTAGGACTGATGCCAGTTAAATTT 4 189 1 AGGACTAGCC 0.98419 -112 AATGTCGCCATGCACATTTACCTTGCAGTTAA 4 229 0 TGCACATACC 0.925997 -72 CACTATTAATAGCAATGTCGCCATGCACATTT 4 242 0 AGCAATTGCC 0.983295 -59 ****** * *** Masking position 2 Map Score: 0.946717 Number of sites scoring better than the average of aligned sites = 605 Number in coding regions = 552 Number in noncoding regions = 53 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 4 ********** No masking Map Score: 9.53751e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 9.53751e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 9.53751e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0