AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i104_Cobalt_Transport_ecoli_hinf_reg_300.orf -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.46 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 yrbF 209 putative ATP-binding component of a transport system #2 HI1087 300 ABC transporter, ATP-binding protein Motif number 1 GATGCTTAATTTTGACTTTATGCGGCTAAAA 1 72 1 TTTACTTTAT 0.910067 -138 CTGGCATTTGTTTTACTTTTTAGCCGCATAA 1 89 0 TTTACTTTTT 0.921436 -121 TTATTATTTATAAGCATTTAT 2 1 1 TTATATTTAT 0.933626 -300 TAAGCATTTATCAATGTTTATTTTCCATAAA 2 21 1 TCATGTTTAT 0.916505 -280 TTTTAATAATACTTTGTTTATGGAAAATAAA 2 37 0 ACTTGTTTAT 0.722531 -264 TTACATTTCTTCATTATTTATTGAATTTTAA 2 62 0 TCATATTTAT 0.951064 -239 TGTAATAGTAACATTCTTTTTGACCTCACTA 2 101 0 ACATCTTTTT 0.860552 -200 TTTTTATAGATTAAAATTTTTGTAATAGTAA 2 121 0 TTAAATTTTT 0.882702 -180 ATAAATTTTATTTCTATTTTTTATAGATTAA 2 138 0 TTTTATTTTT 0.949696 -163 ATAAAATTTATCACTATTTTTATGACCACAT 2 158 1 TCATATTTTT 0.957474 -143 AAGATGAAGTTTTTTCTTTTATCGCAACACA 2 208 0 TTTTCTTTTA 0.729445 -93 ATTAAACAAATCTAACTTTTTCAGGTCATAT 2 242 1 TCTACTTTTT 0.941872 -59 CTGATTGAACTTTTTATTTATAAACGAGATA 2 277 1 TTTTATTTAT 0.942184 -24 *** ******* Masking position 7 Map Score: 14.8947 Number of sites scoring better than the average of aligned sites = 663 Number in coding regions = 428 Number in noncoding regions = 235 Number of orfs with sites within 600 bp upstream = 258 Fraction of orfs with sites within 600 bp upstream = 0.0414391 Motif number 2 CCGCATAAAGTCAAAATTAAGCATCCGTTAC 1 66 0 TAAAATTAAG 0.902372 -144 TTTATGCGGCTAAAAAGTAAAACAAATGCCA 1 88 1 TAAAAGTAAA 0.902606 -122 TATGTTGGGTTCAAGGTTAAATTGAGCGCCA 1 154 1 TAAGGTTAAA 0.96124 -56 CAAAGTATTATTAAAATTCAATAAATAATGA 2 52 1 TAAAATTCAA 0.947048 -249 TTCTATTTTTTATAGATTAAAATTTTTGTAA 2 127 0 TTAGATTAAA 0.858873 -174 TATGACCACATCAAAGTTAAACCAAAGAGAT 2 178 1 TAAAGTTAAA 0.973791 -123 AAACTTCATCTTTAAATTAAACAAATCTAAC 2 227 1 TTAAATTAAA 0.657358 -74 ATATGACCTGAAAAAGTTAGATTTGTTTAAT 2 242 0 AAAAGTTAGA 0.790423 -59 GTTTATAAATAAAAAGTTCAATCAGTTTTAT 2 271 0 AAAAGTTCAA 0.887534 -30 * ********* Masking position 4 Map Score: 6.9947 Number of sites scoring better than the average of aligned sites = 257 Number in coding regions = 171 Number in noncoding regions = 86 Number of orfs with sites within 600 bp upstream = 105 Fraction of orfs with sites within 600 bp upstream = 0.0168648 Motif number 3 TTTAGCCGCATAAAGTCAAAATTAAGCATC 1 72 0 TAAAGTCAAA 0.915307 -138 GCTTCTTTAGTGAGGTCAAAAAGAATGTTA 2 94 1 TGAGGTCAAA 0.991413 -207 TTAACTTTGATGTGGTCATAAAAATAGTGA 2 168 0 TGTGGTCATA 0.971715 -133 TCTAACTTTTTCAGGTCATATAAAACTGAT 2 252 1 TCAGGTCATA 0.984011 -49 ********** Masking position 6 Map Score: 1.8844 Number of sites scoring better than the average of aligned sites = 70 Number in coding regions = 57 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 4 AATTTAACCTTGAACCCAACATATTTACAGA 1 146 0 TAACCCAACA 0.991889 -64 GCTTAGAAAATCAACGCAAGACGAAGGGTGA 1 186 1 TAACGCAAGA 0.991889 -24 ACATCAAAGTTAAACCAAAGAGATGTGTTGC 2 185 1 TAACCAAAGA 0.968713 -116 GTTTTTTCTTTTATCGCAACACATCTCTTTG 2 200 0 TATCGCAACA 0.979818 -101 * ********* Masking position 8 Map Score: 1.04312 Number of sites scoring better than the average of aligned sites = 39 Number in coding regions = 35 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 5 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0