AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i118_SecDF_ecoli_hinf_reg_100.orf -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.46 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 queA 92 synthesis of queuine in tRNA; probably S-adenosylmethionine:tRNA ribosyltransferase-isomerase #2 tgt 55 tRNA-guanine transglycosylase #3 yajC 22 orf, hypothetical protein #4 secD 27 protein secretion; membrane protein, part of the channel #5 HI0240 69 protein-export membrane protein (secD) #6 HI0241 107 conserved hypothetical protein Motif number 1 GTTGCAGGGAGAGCGCCCCGGCACTAGACT 1 41 1 GAGCGCCCCG 0.996948 -52 CGTTTTAAACCAGCGCCGCGGAA 2 4 0 CAGCGCCGCG 0.998477 -52 AATTATTTTCCAGAGCCACGCATTGTGGCT 5 22 1 CAGAGCCACG 0.998245 -48 TTCTAACGCACAGAGCCACAATGCGTGGCT 5 35 0 CAGAGCCACA 0.995979 -35 ********** Masking position 2 Map Score: 8.33706 Number of sites scoring better than the average of aligned sites = 257 Number in coding regions = 250 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 2 TTCTCCACTACGTCAGAAAAACAGTCCAACG 2 32 0 CGTAGAAAAA 0.976328 -24 TTTCTGACGTAGTGGAGAAAAA 2 44 1 AGTGAGAAAA 0.919787 -12 TATTAATAATGAGGGAAATTTA 3 8 1 AATAGGGAAA 0.934748 -15 GGCAATTCCCTTAGGGAAAAATTTTAA 4 8 0 CTTGGGAAAA 0.978699 -20 TGGCTCTGTGCGTTAGAAAAGAAAAGGAAAA 5 47 1 CGTAGAAAAG 0.965138 -23 TAAATTGCTTCATTGGGAAAGGCGAACTAAG 6 40 0 CATGGGAAAG 0.987277 -68 AACTTAAATTAATAAGGAAAACACA 6 93 1 AATAGGAAAA 0.978972 -15 *** ******* Masking position 9 Map Score: 5.60381 Number of sites scoring better than the average of aligned sites = 707 Number in coding regions = 621 Number in noncoding regions = 86 Number of orfs with sites within 600 bp upstream = 104 Fraction of orfs with sites within 600 bp upstream = 0.0167041 Motif number 3 CGGGGCGCTCTCCCTGCAACCTTTACCCCC 1 31 0 TCCCTGCAAC 0.961361 -62 CAGGGAGAGCGCCCCGGCACTAGACTACCC 1 45 1 GCCCCGGCAC 0.979435 -48 GGCACTAGACTACCCGCCTCTTATTTTAGT 1 60 1 TACCCGCCTC 0.984625 -33 TTCCGCGGCGCTGGTTTAAAA 2 2 1 TCCGCGGCGC 0.989333 -54 AGAGCCACAATGCGTGGCTCTGGAAAATAA 5 24 0 TGCGTGGCTC 0.97977 -46 ********** Masking position 6 Map Score: 2.69884 Number of sites scoring better than the average of aligned sites = 926 Number in coding regions = 871 Number in noncoding regions = 55 Number of orfs with sites within 600 bp upstream = 49 Fraction of orfs with sites within 600 bp upstream = 0.00787022 Motif number 4 TCTGGAAAATAATTTAATGTTATTC 5 6 0 AATTTAATGT 0.947737 -64 CCAATGAAGCAATTTATGGTATTTTACGCA 6 55 1 AATTTATGGT 0.980016 -53 TTTCCTTATTAATTTAAGTTAAAAATTTTG 6 83 0 AATTTAAGTT 0.793296 -25 ********** Masking position 6 Map Score: 0.446433 Number of sites scoring better than the average of aligned sites = 15 Number in coding regions = 11 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 5 ATTATATTCTATCCAAAAGGGGGTAAAGGT 1 13 1 ATCCAAAAGG 0.958687 -80 TTTTTCTCCACTACGTCAGAAAAAC 2 41 0 CTCCACTACG 0.986162 -15 TAACGCACAGAGCCACAATGCGTGGCTCTG 5 32 0 AGCCACAATG 0.985087 -38 AATTAATCGCCATAACGTAGGATATTG 6 8 1 CGCCATAACG 0.988911 -100 ********** Masking position 5 Map Score: 0.349751 Number of sites scoring better than the average of aligned sites = 443 Number in coding regions = 418 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 6 ********** No masking Map Score: -6.29951e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -6.29951e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -6.29951e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0