AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i118_SecDF_ecoli_hinf_reg_300.orf -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.46 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 queA 92 synthesis of queuine in tRNA; probably S-adenosylmethionine:tRNA ribosyltransferase-isomerase #2 tgt 55 tRNA-guanine transglycosylase #3 yajC 22 orf, hypothetical protein #4 secD 27 protein secretion; membrane protein, part of the channel #5 HI0240 69 protein-export membrane protein (secD) #6 HI0241 107 conserved hypothetical protein #7 HI0243 64 H. influenzae predicted coding region HI0243 #8 HI0244 300 tRNA-guanine transglycosylase (tgt) Motif number 1 TTTACCCCCTTTTGGATAGAATATAATCG 1 7 0 TTGGTAGAAA 0.84359 -86 GACACTGACTCAGACTAAAATAAGAGGCGGGT 1 71 0 TAGATAAAAA 0.915998 -22 CTCCACTACGTCAGAAAAACAGTCCAACGTTTT 2 28 0 TAGAAAACAT 0.903866 -28 GGCAATTCCCTTAGGGAAAAATTTTAA 4 5 0 TAGGAAAAAT 0.967207 -23 AATGCGTGGCTCTGGAAAATAATTTAATGTTAT 5 13 0 TTGGAAATAT 0.771553 -57 GCTCTGTGCGTTAGAAAAGAAAAGGAAAACT 5 49 1 TAGAAAGAAA 0.83878 -21 CTTATTAATTTAAGTTAAAAATTTTGCGTAAAA 6 76 0 TAGTAAAAAT 0.92015 -32 CTTAAATTAATAAGGAAAACACA 6 95 1 TAGGAAACAA 0.948577 -13 AAGATTTCCTTTGTTAAAAAGTGCGGTCAAAA 7 43 0 TTGTAAAAAT 0.891997 -22 TTAATCATACTAAGGATAAAAATATGACTAAAT 8 112 0 TAGGTAAAAT 0.955406 -189 TTATCCTTAGTATGATTAACAAACTCAGGATCT 8 126 1 TTGATAACAA 0.734821 -175 AACAGGCTTTTTTGTTTAAAAAATCTTCGAACT 8 258 1 TTGTTAAAAA 0.799167 -43 * *** ***** * Masking position 8 Map Score: 9.4962 Number of sites scoring better than the average of aligned sites = 397 Number in coding regions = 270 Number in noncoding regions = 127 Number of orfs with sites within 600 bp upstream = 163 Fraction of orfs with sites within 600 bp upstream = 0.0261805 Motif number 2 TATTCTATCCAAAAGGGGGTAAAGGTTGCA 1 17 1 AAAAGGGGGT 0.981118 -76 GACTAAAATAAGAGGCGGGTAGTCTAGTGC 1 61 0 AGAGGCGGGT 0.990479 -32 TTAATAAAAGTGCGGTAGAAAAATAA 7 7 1 AAAGTGCGGT 0.975568 -58 CCTTTGTTAAAAAGTGCGGTCAAAAAACGT 7 38 0 AAAGTGCGGT 0.975568 -27 GAGATGGCGGTAACCATCTCT 8 2 1 AGATGGCGGT 0.970406 -299 CTCTTTGAGCAGAGGCGGATCTACTAAGAT 8 192 0 AGAGGCGGAT 0.921449 -109 TATGATATCACAAAGCCTGTATTTTTTAAC 8 231 1 CAAAGCCTGT 0.836947 -70 TTTTAAACAAAAAAGCCTGTTAAAAAATAC 8 249 0 AAAAGCCTGT 0.94869 -52 ********** Masking position 3 Map Score: 7.4248 Number of sites scoring better than the average of aligned sites = 874 Number in coding regions = 762 Number in noncoding regions = 112 Number of orfs with sites within 600 bp upstream = 98 Fraction of orfs with sites within 600 bp upstream = 0.0157404 Motif number 3 GGTTGCAGGGAGAGCGCCCCGGCACTAGAC 1 40 1 AGAGCGCCCC 0.974461 -53 ACGTTTTAAACCAGCGCCGCGGAA 2 5 0 CCAGCGCCGC 0.991884 -51 AAATTATTTTCCAGAGCCACGCATTGTGGC 5 21 1 CCAGAGCCAC 0.996287 -49 TTTCTAACGCACAGAGCCACAATGCGTGGC 5 36 0 ACAGAGCCAC 0.994177 -34 CTACTAATAGCCAGTGCTACTTTTCAATAA 8 44 1 CCAGTGCTAC 0.959204 -257 AAATAGCCCGACAGCGGCAACTGGCGGACT 8 162 1 ACAGCGGCAA 0.931764 -139 ********** Masking position 3 Map Score: 6.46634 Number of sites scoring better than the average of aligned sites = 1216 Number in coding regions = 1177 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 35 Fraction of orfs with sites within 600 bp upstream = 0.00562159 Motif number 4 CGTTAGAAAAGAAAAGGAAAACT 5 57 1 GAAAGGAAAC 0.993627 -13 TGCTTCATTGGGAAAGGCGAACTAAGCCCAAT 6 34 0 GAAAGGCAAC 0.976423 -74 AAAATTTTGCGTAAAATACCATAAATTGCTTC 6 60 0 GAAAATACAT 0.744385 -48 AACTTAAATTAATAAGGAAAACACA 6 93 1 ATAAGGAAAC 0.864702 -15 AAGTGCGGTAGAAAAATAAAACGTTTTTTGAC 7 18 1 GAAAATAAAC 0.957416 -47 GCACTTTTTAACAAAGGAAATCTT 7 51 1 AAAAGGAATC 0.864702 -14 GCCTGTTATTGAAAAGTAGCACTGGCTATTAG 8 47 0 GAAAGTACAC 0.982353 -254 TCAATAACAGGCAAAGTAGAATAATGATGACC 8 67 1 GAAAGTAAAT 0.957418 -234 * ****** *** Masking position 5 Map Score: 4.47279 Number of sites scoring better than the average of aligned sites = 506 Number in coding regions = 419 Number in noncoding regions = 87 Number of orfs with sites within 600 bp upstream = 103 Fraction of orfs with sites within 600 bp upstream = 0.0165435 Motif number 5 AAAAACAGTCCAACGTTTTAAACCAGCGCCGC 2 15 0 CAACGTTAAA 0.939365 -41 TTTTTCTCCACTACGTCAGAAAAACAGTCCAA 2 34 0 CTACGTCAAA 0.913561 -22 TTGTGGCTCTGTGCGTTAGAAAAGAAAAGGAA 5 44 1 GTGCGTTAAA 0.993927 -26 TTAATAAAAGTGCGGTAGAAAAATAAAACGT 7 10 1 GTGCGGTAAA 0.992683 -55 TTGTTAAAAAGTGCGGTCAAAAAACGTTTTAT 7 33 0 GTGCGGTAAA 0.992683 -32 TCTGCTCAAAGAGCATTGAAAATATGATATCA 8 209 1 GAGCATTAAA 0.931366 -92 ******* *** Masking position 10 Map Score: 2.87796 Number of sites scoring better than the average of aligned sites = 307 Number in coding regions = 287 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 6 GGTTTAAAACGTTGGACTGTTTTTCTGACG 2 23 1 GTTGGACTGT 0.962826 -33 CATTGGGAAAGGCGAACTAAGCCCAATATC 6 31 0 GGCGAACTAA 0.948005 -77 AGTTGCCGCTGTCGGGCTATTTCGTAGATC 8 154 0 GTCGGGCTAT 0.982575 -147 AGCGGCAACTGGCGGACTATCTTAGTAGAT 8 174 1 GGCGGACTAT 0.992655 -127 TTAAAAAATCTTCGAACTGTTTATTCGTTG 8 273 1 TTCGAACTGT 0.919969 -28 ********** Masking position 8 Map Score: 1.29893 Number of sites scoring better than the average of aligned sites = 244 Number in coding regions = 234 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 7 GAATAACATTAAATTATTTTCCAGA 5 6 1 ACATTAAATT 0.917277 -64 TGCGTAAAATACCATAAATTGCTTCATTGG 6 55 0 ACCATAAATT 0.978812 -53 CAAAATTTTTAACTTAAATTAATAAGGAAA 6 83 1 AACTTAAATT 0.884577 -25 GACCAACTTAATCATAAATTTAGTCATATT 8 95 1 ATCATAAATT 0.944838 -206 ********** Masking position 5 Map Score: 0.462263 Number of sites scoring better than the average of aligned sites = 27 Number in coding regions = 22 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 8 TCTCTTGTCGGCATCAACTACTAATAGCCA 8 27 1 GCATCAACTA 0.980293 -274 AACAAACTCAGGATCTACGAAATAGCCCGA 8 143 1 GGATCTACGA 0.98717 -158 GAGCAGAGGCGGATCTACTAAGATAGTCCG 8 186 0 GGATCTACTA 0.980293 -115 TTTTGCTCCAACGAATAAACAGTT 8 287 0 GCTCCAACGA 0.946986 -14 ********** Masking position 7 Map Score: 0.404155 Number of sites scoring better than the average of aligned sites = 69 Number in coding regions = 63 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 9 ********** No masking Map Score: 1.57984e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: 1.57984e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 11 ********** No masking Map Score: 1.57984e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0