AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i127_Transmembrane_Transport_1_ecoli_hinf_reg_100.orf -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.46 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ycjM 185 putative polysaccharide hydrolase #2 ycjQ 30 putative oxidoreductase #3 ugpA 21 sn-glycerol 3-phosphate transport system, integral membrane protein #4 BIME167 47 BIME #5 ugpB 238 sn-glycerol 3-phosphate transport system; periplasmic binding protein Motif number 1 ATGCGCCGTTTTTTTTTCTGTCACACCTTA 1 35 1 TTTTTTTCTG 0.98197 -151 ACAAATACGCTTTTTCCCTGGTAAAAAATG 1 97 1 TTTTTCCCTG 0.97192 -89 TGGTAAAAAATGATTTCCTGCGTGACTAAA 1 115 1 TGATTTCCTG 0.974948 -71 AATTGACAGTTTATTTTCTGCGGAGTAGTC 1 157 1 TTATTTTCTG 0.976651 -29 TACGGTTAATTCCTGAACTGT 3 7 0 TTAATTCCTG 0.947188 -15 AGACCTTCTATATTTTCCCGCTTATCCGTG 5 44 1 TATTTTCCCG 0.948852 -195 ACAAAAAAGTTATTTTTCTGTAATTCGAGC 5 151 1 TATTTTTCTG 0.966878 -88 ********** Masking position 5 Map Score: 10.3012 Number of sites scoring better than the average of aligned sites = 309 Number in coding regions = 240 Number in noncoding regions = 69 Number of orfs with sites within 600 bp upstream = 71 Fraction of orfs with sites within 600 bp upstream = 0.0114038 Motif number 2 AAAAAAACGGCGCATAAGCGCCGCTCATGG 1 20 0 CGCATAAGCG 0.816941 -166 TGAGCTGACGCAAATAATCTATGGGGATGT 1 68 0 CAAATAATCT 0.81928 -118 CGTCAGCTCACAAATACGCTTTTTCCCTGG 1 88 1 CAAATACGCT 0.976764 -98 AGTGTAATGTCGGATGCGTTTCGCTTATCT 4 13 1 CGGATGCGTT 0.922938 -35 GATGCCAGGTCAGATAAGCGAAACGCATCC 4 24 0 CAGATAAGCG 0.990225 -24 AGATGGGGCACGGATAAGCGGGAAAATATA 5 52 0 CGGATAAGCG 0.987727 -187 CTTGTTGTACCGAATGCGCGAATTCACGCG 5 208 0 CGAATGCGCG 0.99037 -31 ********** Masking position 4 Map Score: 8.58042 Number of sites scoring better than the average of aligned sites = 869 Number in coding regions = 737 Number in noncoding regions = 132 Number of orfs with sites within 600 bp upstream = 82 Fraction of orfs with sites within 600 bp upstream = 0.0131706 Motif number 3 GGGGATGTAAATAAGGTGTGACAGAAAAAAA 1 45 0 ATAAGGGTGA 0.956439 -141 GAAACGAGAGACTACTCCGCA 1 175 0 GAAACGGAGA 0.989643 -11 TGGGTGAGGGAAAATGGGAGATGGGGCACGG 5 69 0 AAAATGGAGA 0.92028 -170 TAAGGTGTCAGAAAGATGACAAGGCGGTGAC 5 104 0 GAAAGAGACA 0.945883 -135 TTGTAAGATAGTAAGGTGTCAGAAAGATGAC 5 115 0 GTAAGGGTCA 0.955369 -124 TGCTCGCGGGGTAACATGACATGCTCGAATT 5 172 0 GTAACAGACA 0.946326 -67 CCGCGAGCATAAAACGCGTGAATTCGCGCAT 5 194 1 AAAACGGTGA 0.974061 -45 CGCATTCGGTACAACAAGAGAGATAAACG 5 220 1 ACAACAGAGA 0.913852 -19 ****** **** Masking position 4 Map Score: 6.55739 Number of sites scoring better than the average of aligned sites = 446 Number in coding regions = 380 Number in noncoding regions = 66 Number of orfs with sites within 600 bp upstream = 81 Fraction of orfs with sites within 600 bp upstream = 0.01301 Motif number 4 GTAAATAAGGTGTGACAGAAAAAAAAACGG 1 40 0 TGTGACAGAA 0.970363 -146 GTATTTGTGAGCTGACGCAAATAATCTATG 1 75 0 GCTGACGCAA 0.968801 -111 TGACGGCGTGGGTGAGGGAAAATGGGAGAT 5 78 0 GGTGAGGGAA 0.990937 -161 ATGACAAGGCGGTGACGGCGTGGGTGAGGG 5 90 0 GGTGACGGCG 0.987362 -149 AAGATAGTAAGGTGTCAGAAAGATGACAAG 5 112 0 GGTGTCAGAA 0.981108 -127 ********** Masking position 3 Map Score: 2.24499 Number of sites scoring better than the average of aligned sites = 822 Number in coding regions = 785 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 40 Fraction of orfs with sites within 600 bp upstream = 0.00642467 Motif number 5 AATGATTTCCTGCGTGACTAAAACCCTTGT 1 123 1 TGCGTGACTA 0.960522 -63 GAAACGAGAGACTACTCCGCAGAA 1 172 0 CGAGAGACTA 0.978629 -14 CACGGATAAGCGGGAAAATATAGAAGGTCT 5 44 0 CGGGAAAATA 0.923359 -195 CATGTTACCCCGCGAGCATAAAACGCGTGA 5 185 1 CGCGAGCATA 0.987 -54 GAGCATAAAACGCGTGAATTCGCGCATTCG 5 198 1 CGCGTGAATT 0.972789 -41 ********** Masking position 9 Map Score: 1.15455 Number of sites scoring better than the average of aligned sites = 385 Number in coding regions = 348 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 47 Fraction of orfs with sites within 600 bp upstream = 0.00754899 Motif number 6 ********** No masking Map Score: -3.24418e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.24418e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -3.24418e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0