AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i131_Transmembrane_Transport_5_ecoli_hinf_reg_300.orf -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.46 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ybiH 216 putative transcriptional regulator Motif number 1 AACTACTCCGAACCGCCCCG 1 1 1 AACTACTCCG 0.994872 -216 AACTACTCCGAACCGCCCCGACCGTTACCG 1 11 1 AACCGCCCCG 0.996291 -206 TCTCCCTGAAAACTACACCGGTAACGGTCG 1 29 0 AACTACACCG 0.994872 -188 AAATGACAAAAACCACAATGTCATGAGGGA 1 71 1 AACCACAATG 0.948361 -146 GCGTCACAAAAACTGCTACACTCCGCTCCC 1 97 0 AACTGCTACA 0.959861 -120 CATACTGGACAACTCCCCTATGGAGTCATA 1 172 1 AACTCCCCTA 0.952606 -45 ********** Masking position 2 Map Score: 8.16535 Number of sites scoring better than the average of aligned sites = 813 Number in coding regions = 746 Number in noncoding regions = 67 Number of orfs with sites within 600 bp upstream = 62 Fraction of orfs with sites within 600 bp upstream = 0.00995824 Motif number 2 GAAAAGGAAAATGACAAAAACCACAATGTC 1 63 1 ATGACAAAAA 0.93688 -154 GTTGTCCAGTATGGCTAAGAATTTTAGCAA 1 155 0 ATGGCTAAGA 0.988689 -62 AATCAAATGATTGATTAAGATTATGACTCC 1 193 0 TTGATTAAGA 0.989724 -24 AATCAATCATTTGATTAAGA 1 207 1 TTGATTAAGA 0.989724 -10 ********** Masking position 7 Map Score: 3.22795 Number of sites scoring better than the average of aligned sites = 59 Number in coding regions = 44 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 3 CTACTCCGAACCGCCCCGACCGTTACCGGT 1 13 1 CCGCCCCGAC 0.998146 -204 CTGCTACACTCCGCTCCCTCATGACATTGT 1 85 0 CCGCTCCCTC 0.998369 -132 GATAATTTATGCGCTGCGTCACAAAAACTG 1 112 0 GCGCTGCGTC 0.996973 -105 ********** Masking position 4 Map Score: 2.3034 Number of sites scoring better than the average of aligned sites = 150 Number in coding regions = 143 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 4 AACTACTCCGAACCGCCCCGACCGTT 1 7 1 TCCGAACCGC 0.940022 -210 ATTTTCCTTTTCAGTATCTCCCTGAAAACT 1 45 0 TCAGTATCTC 0.959575 -172 ATGACAAAAACCACAATGTCATGAGGGAGC 1 73 1 CCACAATGTC 0.97454 -144 GCATAAATTATCCCTGTGACTGGCGTTGCT 1 130 1 TCCCTGTGAC 0.936729 -87 GGGGAGTTGTCCAGTATGGCTAAGAATTTT 1 160 0 CCAGTATGGC 0.993283 -57 CTGGACAACTCCCCTATGGAGTCATAATCT 1 176 1 CCCCTATGGA 0.955912 -41 ********** Masking position 2 Map Score: 1.82942 Number of sites scoring better than the average of aligned sites = 1972 Number in coding regions = 1850 Number in noncoding regions = 122 Number of orfs with sites within 600 bp upstream = 123 Fraction of orfs with sites within 600 bp upstream = 0.0197559 Motif number 5 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0