AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i195_dna_replication1_ecoli_hinf_reg_100.orf -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.46 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI0216 300 type I restriction/modification specificity protein (hsdS) Motif number 1 TTTTGCCAAATGCGGCACATCCTCTTTATCG 1 10 0 TGCGGAATCC 0.973241 -291 TGTGCCGCATTTGGCAAAATCCATATCCTTTG 1 23 1 TTGGCAATCC 0.993011 -278 GTAGTCATTTTGGGCGATTTCTTCAAAGGATA 1 46 0 TGGGCATTCT 0.98358 -255 ATGAACTCAATGCTCAAATTCGTGAAACTGTT 1 136 1 TGCTCATTCG 0.957618 -165 CGCACGCAAGTGGTCAATATTGGTAACAGTTT 1 160 0 TGGTCAATTG 0.919623 -141 TGCAACAATCTTGTCAATTTCCGCACGCAAGT 1 181 0 TTGTCATTCC 0.971925 -120 AAATGTAGGGTGGGCTTCAGCCCANTTTTACG 1 227 1 TGGGCTAGCC 0.984329 -74 TAACAGGTAGTGGGCTAAAGCCCACCCTACGA 1 260 1 TGGGCAAGCC 0.997156 -41 ***** * **** Masking position 1 Map Score: 9.07331 Number of sites scoring better than the average of aligned sites = 1312 Number in coding regions = 1266 Number in noncoding regions = 46 Number of orfs with sites within 600 bp upstream = 52 Fraction of orfs with sites within 600 bp upstream = 0.00835207 Motif number 2 CATTTTGGGCGATTTCTTCAAAGGATATGG 1 43 0 GATTTCTTCA 0.955435 -258 AATCGCCCAAAATGACTACAACCTTGCAGT 1 59 1 AATGACTACA 0.917326 -242 CCACATACGAACTTACTGCAAGGTTGTAGT 1 73 0 ACTTACTGCA 0.97989 -228 CATCAATATTAATCACTTCACGAGTGTCTT 1 109 0 AATCACTTCA 0.951375 -192 CAGTTTCACGAATTTGAGCATTGAGTTCAT 1 136 0 AATTTGAGCA 0.907234 -165 CAATCTTGTCAATTTCCGCACGCAAGTGGT 1 178 0 AATTTCCGCA 0.986911 -123 TTTACCCTTCAATTTCTGCAACAATCTTGT 1 199 0 AATTTCTGCA 0.995174 -102 ********** Masking position 10 Map Score: 6.68821 Number of sites scoring better than the average of aligned sites = 536 Number in coding regions = 463 Number in noncoding regions = 73 Number of orfs with sites within 600 bp upstream = 79 Fraction of orfs with sites within 600 bp upstream = 0.0126887 Motif number 3 TGCCGCATTTGGCAAAATCCATATCCTTTG 1 25 1 GGCAAAATCC 0.971956 -276 CGCCCAAAATGACTACAACCTTGCAGTAAG 1 62 1 GACTACAACC 0.911013 -239 CGTAAAATGGGCTGAAGCCCACCCTACAT 1 229 0 GGCTGAAGCC 0.506388 -72 ACAGGTAGTGGGCTAAAGCCCACCCTACGA 1 262 1 GGCTAAAGCC 0.540848 -39 ********** Masking position 7 Map Score: 4.78929 Number of sites scoring better than the average of aligned sites = 203 Number in coding regions = 194 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 4 TTTGGCAAAATCCATATCCTTTGAAGAAAT 1 32 1 TCCATATCCT 0.901226 -269 AAGGTTGTAGTCATTTTGGGCGATTTCTTC 1 54 0 TCATTTTGGG 0.933497 -247 AACTCAATGCTCAAATTCGTGAAACTGTTA 1 139 1 TCAAATTCGT 0.942504 -162 ACGCAAGTGGTCAATATTGGTAACAGTTTC 1 159 0 TCAATATTGG 0.913708 -142 AACAATCTTGTCAATTTCCGCACGCAAGTG 1 180 0 TCAATTTCCG 0.992783 -121 ATTTTACCCTTCAATTTCTGCAACAATCTT 1 201 0 TCAATTTCTG 0.980592 -100 ********** Masking position 7 Map Score: 3.63153 Number of sites scoring better than the average of aligned sites = 634 Number in coding regions = 574 Number in noncoding regions = 60 Number of orfs with sites within 600 bp upstream = 78 Fraction of orfs with sites within 600 bp upstream = 0.0125281 Motif number 5 AAATTCGTGAAACTGTTACCAATATTGACC 1 151 1 AACTGTTACC 0.991346 -150 AGCCCACCCTACATTTTACCCTTCAATTTC 1 213 0 ACATTTTACC 0.976744 -88 TTAGCCCACTACCTGTTATCGTAAAATGG 1 248 0 ACCTGTTATC 0.991346 -53 ********** Masking position 8 Map Score: 0.328374 Number of sites scoring better than the average of aligned sites = 207 Number in coding regions = 190 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 6 CACGAGTGTCTTTTTGTTCCACATACGAAC 1 91 0 TTTTTGTTCC 0.993099 -210 GGTGTTTTTTTATTGTTCCTCGTAGGGTG 1 282 0 TTATTGTTCC 0.993095 -19 ********** Masking position 5 Map Score: 0.114646 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0