AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i195_dna_replication1_ecoli_hinf_reg_300.orf -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.46 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI0216 300 type I restriction/modification specificity protein (hsdS) Motif number 1 CGATAAAGAGGATGTGCCGCATTTGGCAAAA 1 10 1 GGATTCCGCA 0.974252 -291 CAAAGGATATGGATTTTGCCAAATGCGGCACA 1 23 0 GGATTGCCAA 0.99328 -278 TATCCTTTGAAGAAATCGCCCAAAATGACTAC 1 46 1 AGAATGCCCA 0.984207 -255 AACAGTTTCACGAATTTGAGCATTGAGTTCAT 1 136 0 CGAATGAGCA 0.959195 -165 AAACTGTTACCAATATTGACCACTTGCGTGCG 1 160 1 CAATTGACCA 0.9225 -141 ACTTGCGTGCGGAAATTGACAAGATTGTTGCA 1 181 1 GGAATGACAA 0.972985 -120 CGTAAAATGGGCTGAAGCCCACCCTACATTT 1 227 0 GGCTAGCCCA 0.984924 -74 TCGTAGGGTGGGCTTTAGCCCACTACCTGTTA 1 260 0 GGCTTGCCCA 0.997266 -41 **** * ***** Masking position 12 Map Score: 9.07331 Number of sites scoring better than the average of aligned sites = 1312 Number in coding regions = 1266 Number in noncoding regions = 46 Number of orfs with sites within 600 bp upstream = 52 Fraction of orfs with sites within 600 bp upstream = 0.00835207 Motif number 2 CCATATCCTTTGAAGAAATCGCCCAAAATG 1 43 1 TGAAGAAATC 0.951874 -258 ACTGCAAGGTTGTAGTCATTTTGGGCGATT 1 59 0 TGTAGTCATT 0.911004 -242 ACTACAACCTTGCAGTAAGTTCGTATGTGG 1 73 1 TGCAGTAAGT 0.978239 -228 AAGACACTCGTGAAGTGATTAATATTGATG 1 109 1 TGAAGTGATT 0.947508 -192 ATGAACTCAATGCTCAAATTCGTGAAACTG 1 136 1 TGCTCAAATT 0.900223 -165 ACCACTTGCGTGCGGAAATTGACAAGATTG 1 178 1 TGCGGAAATT 0.985827 -123 ACAAGATTGTTGCAGAAATTGAAGGGTAAA 1 199 1 TGCAGAAATT 0.994771 -102 ********** Masking position 8 Map Score: 6.68821 Number of sites scoring better than the average of aligned sites = 536 Number in coding regions = 463 Number in noncoding regions = 73 Number of orfs with sites within 600 bp upstream = 79 Fraction of orfs with sites within 600 bp upstream = 0.0126887 Motif number 3 TGCCGCATTTGGCAAAATCCATATCCTTTG 1 25 1 GGCAAAATCC 0.971934 -276 CGCCCAAAATGACTACAACCTTGCAGTAAG 1 62 1 GACTACAACC 0.910919 -239 CGTAAAATGGGCTGAAGCCCACCCTACAT 1 229 0 GGCTGAAGCC 0.506366 -72 ACAGGTAGTGGGCTAAAGCCCACCCTACGA 1 262 1 GGCTAAAGCC 0.540719 -39 ********** Masking position 7 Map Score: 4.78929 Number of sites scoring better than the average of aligned sites = 203 Number in coding regions = 194 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 4 CGAGTGTCTTTTTGTTCCACATACGAACTT 1 89 0 TTTGTTCCAC 0.985278 -212 AGTGATTAATATTGATGAACTCAATGCTCA 1 122 1 ATTGATGAAC 0.941637 -179 AATTGACAAGATTGTTGCAGAAATTGAAGG 1 194 1 ATTGTTGCAG 0.984898 -107 GTGTTTTTTTATTGTTCCTCGTAGGGTGGG 1 280 0 ATTGTTCCTC 0.985738 -21 ********** Masking position 6 Map Score: 1.23863 Number of sites scoring better than the average of aligned sites = 282 Number in coding regions = 255 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 5 AAATTCGTGAAACTGTTACCAATATTGACC 1 151 1 AACTGTTACC 0.990085 -150 AGCCCACCCTACATTTTACCCTTCAATTTC 1 213 0 ACATTTTACC 0.973412 -88 TTAGCCCACTACCTGTTATCGTAAAATGG 1 248 0 ACCTGTTATC 0.990085 -53 ********** Masking position 8 Map Score: 0.328374 Number of sites scoring better than the average of aligned sites = 207 Number in coding regions = 190 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 6 AAAAAGACACTCGTGAAGTGATTAATATTG 1 106 1 TCGTGAAGTG 0.993053 -195 ATGCTCAAATTCGTGAAACTGTTACCAATA 1 145 1 TCGTGAAACT 0.972258 -156 CTACCTGTTATCGTAAAATGGGCTGAAGC 1 240 0 TCGTAAAAT 0.783436 -61 TTATTGTTCCTCGTAGGGTGGGCTTTAGCC 1 272 0 TCGTAGGGTG 0.969512 -29 ********** Masking position 4 Map Score: 0.120606 Number of sites scoring better than the average of aligned sites = 249 Number in coding regions = 230 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0